Jeph Jacques's comics discussion forums

Fun Stuff => CHATTER => Topic started by: FiskFisk33 on 28 Jun 2008, 16:51

Title: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: FiskFisk33 on 28 Jun 2008, 16:51
(http://omglol.kerrolisaa.com/1/5175.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 29 Jun 2008, 08:07
I've rebooted the pointless thread.

If we could have less lolcats and other really overplayed shit in this one that would be great!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 29 Jun 2008, 10:36
(http://img.photobucket.com/albums/v619/ackblom12/TommyRhino.jpg)

I had to do something with that picture.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 29 Jun 2008, 10:39
Dude that rhino was adorable. Pity you didn't get a good picture of her blowing bubbles in the algae.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 29 Jun 2008, 12:36
REPOSTING FUCKING AWESOME GATORMAN


(http://i28.photobucket.com/albums/c213/hey_there_fatty/OHHELLYES.gif)

 Also this is probably my favorite Nothing Nice To Say strip.


(http://i28.photobucket.com/albums/c213/hey_there_fatty/A-wuh-oh.gif)





Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Lines on 29 Jun 2008, 12:51
I had to do something with that picture.

Hehehehehe!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 29 Jun 2008, 14:10
REPOSTING FUCKING AWESOME GATORMAN

I think you mean Ace Rimmer.

What a guy!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Mister Arkadin on 29 Jun 2008, 15:48
(http://i290.photobucket.com/albums/ll245/gayisnotasynonymforshitty/800px-Epic_thread36.png)
(http://i290.photobucket.com/albums/ll245/gayisnotasynonymforshitty/americanviewvd8.gif)
(http://i290.photobucket.com/albums/ll245/gayisnotasynonymforshitty/Mr20T20Pawa.gif)
(http://i290.photobucket.com/albums/ll245/gayisnotasynonymforshitty/no-buttfucking.gif)
(http://i290.photobucket.com/albums/ll245/gayisnotasynonymforshitty/guitarhero.jpg)
(http://i290.photobucket.com/albums/ll245/gayisnotasynonymforshitty/Homosexuals.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 29 Jun 2008, 18:39
I guess I can delete everything I put in the llast thread



or maybe I will just transfer them over here
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gridgm on 29 Jun 2008, 19:36
can you at least give us a source on that bunny watchmen picture....that was awesomeness in a nutshell
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Plasticity on 29 Jun 2008, 20:45
(http://uploads.imagup.com/03/1208227226_2w2ebsi.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 29 Jun 2008, 21:47
Man that dog is a real asshole.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: E. Spaceman on 29 Jun 2008, 22:30
(http://i157.photobucket.com/albums/t55/jjgp1112/Dog_jumps_carwindow1-1.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 29 Jun 2008, 23:55
I can't go to my job interview tomorrow, as it's on a military base and I can't find my id card. A side note, if I start a thread for discussing the wonders of scene girls will it get deleted and I the mighty banhammer?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 30 Jun 2008, 00:21
(http://i74.photobucket.com/albums/i247/epictetus47/birdsurf.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 30 Jun 2008, 01:32
Please tell me that's real and not a photochop.  That is awesome.

Also, I almost dread asking this, but what are the "wonders" of scene girls that you are talking about?

Please don't bother to answer if you suspect that your response will make me think you are a repulsive jerk.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 30 Jun 2008, 07:43
(http://cassland.org/images/antivirus.jpg)

(http://cassland.org/images/piglet.jpg)

(http://cassland.org/images/HorseAndCart.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 30 Jun 2008, 08:35
I have no idea whether it's real since I stole it from a similar thread elsewhere, but I hope it is too. I believe it's real, I can imagine it happening and really the world is better off with little birds riding on the back of bigger birds.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 30 Jun 2008, 08:39
Sure, it's better off if you're a COMMUNIST
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: bicostp on 30 Jun 2008, 10:55
Presenting the Redneck Rollercoaster

(http://img50.imageshack.us/img50/627/redneckrollercoasterqb4.jpg) (http://www.youtube.com/watch?v=sVJHfLibCb4)
The picture's a link. Holy crap.

Check out the rest of that guy's videos, they do a lot of fun crap at that farm.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 30 Jun 2008, 16:43
There's style, there's good style, and then there's

(http://www.ila.com/graphics/poohprom.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 30 Jun 2008, 17:09
(http://img176.imageshack.us/img176/2017/goodendzz4.jpg)

(http://img176.imageshack.us/img176/6765/calvinandhobbesnb2.jpg)

(http://img209.imageshack.us/img209/7706/sofuckingcuteyh6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Sythe on 30 Jun 2008, 17:42
(http://content.answers.com/main/content/wp/en/a/a2/Manos-dvd_cover.jpg)

I helped!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 30 Jun 2008, 21:17
Matt that first Calvin & Hobbes pic made me go DAAAAAWWWWWWWW
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 30 Jun 2008, 21:26
Man, that gal in the Winnie dress looks super amped to be wearing it, while the guy is all like "man, the things I fuckin' do"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 30 Jun 2008, 21:58
I guess I don't get the first Calvin and Hobbes one.  Calvin is Dad and the little girl is Calvin and Susie's daughter?  Or the girl is Susie and her Dad just happens to look something like an adult Calvin.  Either way, where were they today?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 30 Jun 2008, 22:03
 The dude is Calvin and the girl is his daughter. The little tear indicates that he is happy that his daughter is having fun with Hobbes, and possibly misses those days.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 30 Jun 2008, 22:06
Guys guys guys.  I think we missed that cute-ass picture of Amiterasu. WHAT WERE WE THINKING
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 30 Jun 2008, 22:15
Also, I almost dread asking this, but what are the "wonders" of scene girls that you are talking about?

Please don't bother to answer if you suspect that your response will make me think you are a repulsive jerk.
They will buy merch from any band so long as they get to feel like they are actually supporting something worthwhile. Plus they keep metalheads away from an event just by showing up, and I hate metalheads.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Plasticity on 30 Jun 2008, 23:34
The dude is Calvin and the girl is his daughter. The little tear indicates that he is happy that his daughter is having fun with Hobbes, and possibly misses those days.

It is one of the best things I have seen on the internet in a really long time.

Also, I almost dread asking this, but what are the "wonders" of scene girls that you are talking about?

Please don't bother to answer if you suspect that your response will make me think you are a repulsive jerk.
They will buy merch from any band so long as they get to feel like they are actually supporting something worthwhile. Plus they keep metalheads away from an event just by showing up, and I hate metalheads.

They also tend to have nipple piercings and tattoos which is cool
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 01 Jul 2008, 00:03
INTERCOURSE
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: evernew on 01 Jul 2008, 02:07
(http://i25.tinypic.com/x0qr60.jpg)

Oh, Maddox ...

btw, when did 'scene' people decide it was cool to be part of a 'scene'?
I thought they all turned from mainstream to be something else.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 01 Jul 2008, 02:30
 That is one of those things that goes without saying, Evernew. Henceforth I will use a new acronym for things that are so dumb, how dumb they are goes without saying; "GWS".
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 01 Jul 2008, 10:17
The dude is Calvin and the girl is his daughter. The little tear indicates that he is happy that his daughter is having fun with Hobbes, and possibly misses those days.

Thanks.  I'm a bonehead.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 01 Jul 2008, 13:09
(http://img115.imageshack.us/img115/3034/snapshot2020outthewindods0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 01 Jul 2008, 15:12
(http://heroforsale.net/space/mr-t.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: DoubleAW on 01 Jul 2008, 15:17
what.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 01 Jul 2008, 16:12
I imagine quite a few of you have seen this before but it makes me laugh every time I see it.

(http://failblog.files.wordpress.com/2008/06/fb125.jpg?w=500&h=357)

(http://www.funnyharhar.com/img2/1194963551494.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 01 Jul 2008, 17:52
 See, that Bambi picture is perfectly fine and hilarious without the FAIL caption. Why do people feel the need to add something to an already perfectly humorous picture? I'll tell you why; people are dumb and wish they had found the picture, so they add a caption or a stupid fucking photoshop.

 Also I like how every drug besides PCP is visually represented by a picture in that Mr. T picture.

 HOW THE HELL DOES MR. T VISUALLY REPRESENT PCP

 MR. T DON'T KNOW WHAT THAT SHIT LOOK LIKE
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 01 Jul 2008, 17:58
I think it's funnier that apparently, Mr. T's cock is a guide to life.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 01 Jul 2008, 19:20
(http://img399.imageshack.us/img399/6956/dudewouldloseva3.jpg)

(http://img399.imageshack.us/img399/4938/whatub5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 01 Jul 2008, 19:24
They also tend to have nipple piercings and tattoos which is cool
irrelevant and not really.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 01 Jul 2008, 19:47
Link because it is HUGE. (http://twi.gs/wp-content/uploads/2007/12/2a906067e09f5b559875e0f22b3cd1832d0debe5.jpg)

But it's funny so you should click the link.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 01 Jul 2008, 19:51
Flouride isn't dangerous.

Now, Dihydrogen Monoxide, that shit is dangerous.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 01 Jul 2008, 20:05
A damn convincing cause effect:

Quote
fewer visits to the dentist's office make for less frequent exposure to reader's digest. less frequent exposure to reader's digest causes child to be insufficiently alerted to the dangers of Communism
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 01 Jul 2008, 21:15
Someone is a fan of Dr. Strangelove.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 02 Jul 2008, 04:32
Man, who isn't? That movie was great.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 02 Jul 2008, 06:11
That reminds me, I don't have that movie on DVD. I better fix that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 02 Jul 2008, 11:59
(http://zoomcritic.com/images/weird_fish/5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: DoubleAW on 02 Jul 2008, 12:07
Um... why do you have that picture?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 02 Jul 2008, 12:11
just look at his avatar, and all will become clear in time
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 02 Jul 2008, 12:14
(Hint: Jordan loves cock)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: DoubleAW on 02 Jul 2008, 12:18
Yeah, I figured that out. I bet they love him back.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 02 Jul 2008, 13:02
(http://www.tofslie.com/hey/wp-content/uploads/2008/06/carparking.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 02 Jul 2008, 14:21
would've been more appropriate to slap one of these (http://www.iparklikeanidiot.com/) on it. They're harder to disregard, what with the adhesive and all.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 02 Jul 2008, 15:28
DUDES

HITCH GETS WATERBOARDED (http://www.vanityfair.com/politics/features/video/2008/hitchens_video200808)

awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 02 Jul 2008, 16:29
(http://www.chrischynoweth.com/images/CamelToads.jpeg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 02 Jul 2008, 17:07
Hahaha, that's hilarious.
To keep it random:
(http://www.jeremygaddis.com/blog/wp-content/uploads/2007/12/11982893749011.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 02 Jul 2008, 17:08
(http://img.photobucket.com/albums/v619/ackblom12/sweetsatisfaction.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 02 Jul 2008, 18:20
(http://www.film1.nl/images/plaatjes/44319.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 02 Jul 2008, 18:23
I think my brain done died
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 02 Jul 2008, 18:24
Spite, mostly.

Spite at life.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 02 Jul 2008, 18:31
Why Chow Yun Fat, why?

(http://img76.imageshack.us/img76/6150/sniperdadcd7.jpg)

The proper way to take care of a baby (http://img364.imageshack.us/img364/8337/somegeneraltipspp1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 02 Jul 2008, 19:17
It's called a road. (http://www.youtube.com/watch?v=FuX5_OWObA0)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: J-cob9000 on 02 Jul 2008, 19:43
(http://www.film1.nl/images/plaatjes/44319.jpg)
Who the hell announces a movie like this and doesn't notice all the negative feedback on the internet?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 02 Jul 2008, 19:59
The type of people that would make a Dragonball movie. Clearly.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 02 Jul 2008, 19:59
That movie is going to be fucking awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 02 Jul 2008, 20:31
It so will. At least worth a rental and a bottle of something cheap and awful.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 02 Jul 2008, 21:25
The GI Joe is gonna suck. Destro has no mask and no son WTF?! The casting is all wrong and if it's called the Rise of Cobra why is Destro leading it? He didn't become anything more than an arms dealer until after COBRA had been established.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 02 Jul 2008, 21:56
Destro has no mask and no son WTF?!

If it's any consolation, I'm sure these will be the least of the movie's problems.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 02 Jul 2008, 23:51
The GI Joe is gonna suck. Destro has no mask and no son WTF?! The casting is all wrong and if it's called the Rise of Cobra why is Destro leading it? He didn't become anything more than an arms dealer until after COBRA had been established.

According to IMDB (http://www.imdb.com/title/tt1046173/), there is a Cobra Commander, so it makes sense that Destro will be the arms dealer supplying the fledling CC with the arms he needs to create a terrorist organization.

Do you remember how Cobra Commander was a used car salesman before he started a terrorist organization? Did you really expect anyone to make a good movie about that?

No, but Sienna Miller is hot. And there will be lots of 'splosions.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Coreh on 02 Jul 2008, 23:56
guys okay. a long time ago, i saw this really funny lord of the rings gif that had the "and my axe! and my bow!" line
but i can't remember anything else but that part.

i need it because whenever my friends and i are all stoned it comes up but NONE of us can remember it

can't imagine why....

so yeah
prease?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Coreh on 03 Jul 2008, 00:24
i don't know :(

i don't hink so..

i'm pretty sure it started out with something  completely lotr-unrelated
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 03 Jul 2008, 06:52
Something like THIS?:
(http://i15.photobucket.com/albums/a352/gfunk461/gifs/GimliAxe.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 03 Jul 2008, 06:59
Oh dear god, that's just epilepsy waiting to happen.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 03 Jul 2008, 07:00
I think he means something more along the lines of one non-lotr person saying something about "you have my ______" followed by the dwarf and the elf piping up.

I've seen that joke in text, but I can't think of a gif I've seen.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 03 Jul 2008, 09:14
(http://www.chrisd.ca/blog/wp-content/uploads/2008/07/touch_of_beauty_beaver.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Aimless on 03 Jul 2008, 10:32
(http://img156.imageshack.us/img156/4687/j5sk2adxfklhgxixus3upfyfe1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: clockworkjames on 03 Jul 2008, 10:39
If we could have less lolcats and other really overplayed shit in this one that would be great!
Original content in (my) QC?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 03 Jul 2008, 10:59
Someone from the L.A. Times managed to track down Rick Astley and ask him what he thought about Rickrolling.  He actually sounds like a pretty cool guy.

Not a Rickroll, I promise (http://latimesblogs.latimes.com/webscout/2008/03/rick-astley-kin.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ummmkay on 03 Jul 2008, 13:05
Quote from: article
Rick Astley, the singer who made the song famous in 1987 and who is not dead.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gridgm on 03 Jul 2008, 16:33
Something like THIS?:
(http://i15.photobucket.com/albums/a352/gfunk461/gifs/GimliAxe.gif)

(http://i98.photobucket.com/albums/l249/gridgm/You-Are-Seizure_deserving.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 03 Jul 2008, 18:48
HOLY SHIT!!!!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 03 Jul 2008, 19:45
congratulations sir, you have made my headache worse

(http://img49.imageshack.us/img49/9236/grovergq6.jpg)

(http://img49.imageshack.us/img49/3567/realfuturamasn6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 03 Jul 2008, 21:12
Destro has no mask and no son WTF?!

If it's any consolation, I'm sure these will be the least of the movie's problems.
Yeah but they will be my biggest gripes until I see the movie
The GI Joe is gonna suck. Destro has no mask and no son WTF?! The casting is all wrong and if it's called the Rise of Cobra why is Destro leading it? He didn't become anything more than an arms dealer until after COBRA had been established.

According to IMDB (http://www.imdb.com/title/tt1046173/), there is a Cobra Commander, so it makes sense that Destro will be the arms dealer supplying the fledling CC with the arms he needs to create a terrorist organization.

Do you remember how Cobra Commander was a used car salesman before he started a terrorist organization? Did you really expect anyone to make a good movie about that?

No, but Sienna Miller is hot. And there will be lots of 'splosions.
I'm well aware of Cobra Commander's presence however all the promotional material has said that Destro is in charge and that is incorrect. Are you aware that Cobra Commander also went vigilante for a bit before becoming Cobra Commander and even teamed up with the man that would become Snake Eyes? Who cares how attractive a person is? How good of an actor they are is way more important, not that she's a bad actor. I prefer a good story and accuracy to mindless action, I guess I'm just a nerd that way.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 03 Jul 2008, 21:29
Quote from: article
Rick Astley, the singer who made the song famous in 1987 and who is not dead.

--And can I just add, he looks pretty damn fine (you know...for a guy his age and considering what he looked like back then...) Just me? Okay. Whatever.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 04 Jul 2008, 02:28
Nah, I'd dick Rick.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caspian on 04 Jul 2008, 03:30
he was pretty humble/realistic about the whole thing. Quite a cool guy, it seems.

Also: RUNNING WILD- GATES TO PURGATORY

that is all
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 04 Jul 2008, 15:09
That movie is going to be fucking awesome.

It'll be mad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 05 Jul 2008, 05:26
(http://i223.photobucket.com/albums/dd93/Zootallures316/MidgetWrestling.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mat_mantra on 05 Jul 2008, 13:23
Points for distance and form.  Landing could have been better
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 05 Jul 2008, 23:51
http://www.tastespotting.com/

honestly I just had to post it somewhere.

Edit: Okay something to balance that last link:
http://www.thesneeze.com/mt-archives/cat_steve_dont_eat_it.php
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 06 Jul 2008, 08:01
That second link is very similar to a Dave Barry article I read years ago. The only difference was Barry was testing Armour Potted Meat Product, not Ralph's, along with several other food items at the same time.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 06 Jul 2008, 15:44
I love this icon. I wish I'd created it but I can't claim the credit.

(http://homepage.ntlworld.com/richard.townsend1/gunbunny.gif)

For some reason it's running a little faster than I remember.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 06 Jul 2008, 18:04
Nothing will ever be better than the one of the guy attacking a door.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 06 Jul 2008, 18:23
(http://farm4.static.flickr.com/3083/2593835674_afa81b42f0.jpg)
(http://farm4.static.flickr.com/3169/2593838418_90ac0d58bd.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gridgm on 06 Jul 2008, 18:26
Nothing will ever be better than the one of the guy attacking a door.
(http://i98.photobucket.com/albums/l249/gridgm/janye.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Plasticity on 06 Jul 2008, 20:58
Social Bacon that is amazing.

Gridgm, I don't get it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 06 Jul 2008, 20:58
(http://img387.imageshack.us/img387/1912/carebearxg4.jpg)

(http://img387.imageshack.us/img387/6209/metalonlyfo5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 07 Jul 2008, 08:30
(http://kuvaton.com/kuvei/mario7.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Plasticity on 07 Jul 2008, 13:37
Gridgm, I don't get it.

Watch Firefly and be enlightened. Seriously. It is the one of best TV shows around.

I really don't like Joss Whedon.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 07 Jul 2008, 13:40
Wow, there actually IS another one out there somewhere.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 07 Jul 2008, 13:48
Anyone for a game of conkers? (http://news.bbc.co.uk/2/hi/uk_news/7493547.stm)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 07 Jul 2008, 13:56
...is Snowdonia a real place?

because it sounds magical.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 07 Jul 2008, 14:03
Wow, there actually IS another one out there somewhere.

You know, that caption under the Movies, TV, and Books Forum couldn't have been a dead giveaway
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 07 Jul 2008, 14:43
Huh. I hadn't actually noticed he changed the captions again.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 07 Jul 2008, 14:50
I think we are all just kinda used to Jeph's drunken forum-altering antics.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 07 Jul 2008, 15:42
Oh yes, Snowdonia is a real and magical place, situated as it is on the borders of Raindonia, Sleetdonia and Moria.

Don't even get me started on the Cairngorms.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 07 Jul 2008, 17:28
Well it all depends on why he doesn't like Whedon. I mean, if it were because Whedon insulted him or stole his girlfriend or something then sure that's not relevant to the quality of Whedon's TV shows. However, in the absence of such clarifying details we should assume that the reason is something relevant, namely that he doesn't like Joss Whedon because he thinks Whedon's TV shows are bad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gridgm on 07 Jul 2008, 19:10
i'm either/or for whedon he can do pure gold or he can drive something into the ground (see the second half of astonishing x-men for a good example)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 07 Jul 2008, 19:51
why should someone try to put others off from watching it because the person doesn't like it himself?

Sorry to keep picking at this when you seemed to be dropping the matter, but when did he say other people shouldn't watch it? All I see is him explaining why he doesn't watch it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 07 Jul 2008, 20:14
C'mon guys, more random shit

(http://img146.imageshack.us/img146/595/didnothingim3.jpg)

(http://img135.imageshack.us/img135/6730/pleasedontjx8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Plasticity on 07 Jul 2008, 22:19
I really don't like Joss Whedon.

Why, does that make Firefly a bad show? Should someone else not watch Firefly because you don't like the guy who made it? Makes no sense to me, at least.

What? I said I am not a fan of Joss Whedon, and that I didn't get a joke. That translates into me saying no one else should watch it? I don't dislike him as a person,  I just think he is kind of a hack, and all his characters talk exactly the same way.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 07 Jul 2008, 22:52
(http://i26.photobucket.com/albums/c115/MCDickie/snapshot_d4e04064_34e04067.jpg) I think this speaks for itself
(http://i26.photobucket.com/albums/c115/MCDickie/periodictable.jpg)
(http://i26.photobucket.com/albums/c115/MCDickie/rainbowtrout.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Hunter on 07 Jul 2008, 23:17
(http://img232.imageshack.us/img232/9648/picture1fc9.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 08 Jul 2008, 04:57
Sergeant Sofa says GET THIS POINT OFF MY POINTLESS THREAD!
(http://op-for.com/camo.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 08 Jul 2008, 10:55
i seriously looked at that picture for about a minute before i even realized what was going on.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 08 Jul 2008, 11:33
Now we just need to ship our grandma's sofas to Iraq and Afghanistan to save our troops.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mat_mantra on 08 Jul 2008, 14:31
Sergeant Sofa says GET THIS POINT OFF MY POINTLESS THREAD!
(http://op-for.com/camo.jpg)

Man, reminds me of how close we came to wearing blue BDU's.  Not a big fan of the new Air Force uniform, but it's definitely better than what they first proposed
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Drill King on 08 Jul 2008, 16:54
I know I'm kinda late, but I'd just like to say I would so do Jayne
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 08 Jul 2008, 19:47
I have a penis and I would let Jayne penetrate me so much.

So much.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 08 Jul 2008, 20:56
But we all know you're gay.





Ohhhhhhhhhhhhhhhhhh
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 08 Jul 2008, 20:57
Feel the burn!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 08 Jul 2008, 20:58
Do you feel it?









Honestly though I'm sorry I'm not really making fun of you I don't like making fun of people and you're a cool dude and I know you're not gay not that there's anything wrong with that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Plasticity on 08 Jul 2008, 21:11
What is wrong with internet people!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scarychips on 08 Jul 2008, 21:26
Would be easier to ask what is not wrong with internet people.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 08 Jul 2008, 22:09
shorter list

(http://img92.imageshack.us/img92/7717/cookiesid6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 09 Jul 2008, 07:45
Man, is that what Monster was about? I heard something totally different!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 09 Jul 2008, 09:41
Let's all go to New Zealand. (http://www.invadenewzealand.com/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 09 Jul 2008, 11:54
HAHAHAHAHAHA!
Oh wow, that video was amazing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 09 Jul 2008, 14:46
I saw that last night o the ABC, there is this show called the Gruen Transfer (http://www.abc.net.au/tv/gruentransfer/) and it's about advertising in general. On the site you can watch previous episodes and construct your own adds for a few different products. That add in specific is from a segment called The Pitch where two Australian add angencies try to sell the "unsellable". Previous examples include: whale meat, Baghdad tourism and the Australian Democrat Party.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 09 Jul 2008, 14:58
the Australian Democrat Party.

i don't get it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 09 Jul 2008, 15:12
Nobody likes the Australian Democratic Party.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 09 Jul 2008, 15:13
Quote
Over two decades, the Democrats achieved representation in the legislatures of the ACT, South Australia, New South Wales, Western Australia and Tasmania as well as Senate seats in all six states. However, at the 2004 and 2007 elections, all seven of its Senate seats were lost. Support at the state level had also dwindled.

No one really cares all that much about the Democrats.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scarychips on 09 Jul 2008, 15:53
(http://img81.imageshack.us/img81/8131/rprofessorge4.jpg)

(http://img510.imageshack.us/img510/1541/060515nyorker1rugen0.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 09 Jul 2008, 22:09
(http://i216.photobucket.com/albums/cc183/hexotic_01/Funny/Amphibiousattacktigers.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 10 Jul 2008, 01:17
This is the best image on Wikipedia:

NSFW, I suppose (http://en.wikipedia.org/wiki/Image:Smotherbox-inuse-drawing-color.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 10 Jul 2008, 18:34
Why is it that the person was too lazy to find pictures of actual smother boxes?

(http://img228.imageshack.us/img228/4630/poorgambitzu9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 10 Jul 2008, 23:35
(http://dummcomics.com/images/comics/kimbo/KimbosFirstWritingJob.jpg)
(http://dummcomics.com/images/comics/kimbo/KimbosPrivateEyePt1.jpg)
(http://dummcomics.com/images/comics/kimbo/1930_privateeye2final.jpg)

dummcomics.com has more
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 11 Jul 2008, 01:28
Was anyone else turned on by that comic?

No?

Good.

ME NEITHER, YA' WEIRDOS.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 11 Jul 2008, 04:01
(http://kuvaton.com/kuvei/cute.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 11 Jul 2008, 05:38
I was gonna make a point about how Jeph must love getting hammered and changing the names of stuff in here, but that pic is absolutely wonderful, and I find I can say no ill.

 :-)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 11 Jul 2008, 06:12
Zombie owl wants your delicious braaaaiiins.

Goth owl finds pleasure in being devoured.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 11 Jul 2008, 23:34
No one really cares all that much about the Democrats.

I voted for the Democrats D:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 12 Jul 2008, 02:46
Oh calm down, my opinion doesn't really matter.

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ImRonBurgundy? on 13 Jul 2008, 14:40
Actual Family Circus panel from the 1980's:
(http://img.photobucket.com/albums/v32/TheHusseinSkank/backfire.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 13 Jul 2008, 17:50
(http://img75.imageshack.us/img75/9656/sohappyuf9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Mr. Mojo on 13 Jul 2008, 19:29
(http://img75.imageshack.us/img75/9656/sohappyuf9.jpg)

OWNED! Extra win points because she's smiling aswell.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 13 Jul 2008, 20:15
Don't quote the post directly above yours, don't quote pictures, and especially don't do both at the same time.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Mr. Mojo on 13 Jul 2008, 20:52
Apologies.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 14 Jul 2008, 03:32
Caption: HANDS OFF MY FUCKIN' FRISBEE, LADY!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 14 Jul 2008, 17:45
(http://upload.wikimedia.org/wikipedia/commons/6/62/Steamtop.jpg)

WANT
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 14 Jul 2008, 17:54
As cool as that is, wait'll you see how one guy refined the idea even further. (http://steampunkworkshop.com/daveveloz.shtml)

Also, those computers are cool but they need this. (http://steampunkworkshop.com/truly-awesome-steampunk-mouse)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 14 Jul 2008, 19:09
 But the one up there has Mr. Teal on it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 14 Jul 2008, 21:46
(http://img205.imageshack.us/img205/2909/rapeeveyc7.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 14 Jul 2008, 21:53
But the one up there has Mr. Teal on it.

That is the 2004 Shrovis-Bishopthorpe Thruppeny II. That was from the era when they realized consumers might like to access the internet, but still fiercely refused them that option. Instead, it would give you a special internet consisting of little else than lovely pictures of finches and other passerine birds.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Plasticity on 15 Jul 2008, 01:22
Some friends of mine recently discussed the idea of Steam Crunk.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: morca007 on 15 Jul 2008, 01:37
Ancient records suggest that this kind of experiment was carried out from time to time, though the authenticity of these records can neither be confirmed nor denied. An early record of an experiment of this kind can be found in Herodotus's History. According to Herodotus, after carrying out such an experiment, the Egyptian pharaoh Psammetichos concluded the Phrygian race must predate the Egyptians since the children had first spoken the Phrygian word bekos, meaning "bread."[2]

An alleged experiment carried out by Holy Roman Emperor Frederick II in the 13th century saw young infants raised without human interaction in an attempt to determine if there was a natural language that they might demonstrate once their voices matured. It is claimed he was seeking to discover what language would have been imparted unto Adam and Eve by God.

The experiments were recorded by the monk Salimbene di Adam in his Chronicles, who wrote that Frederick bade "foster-mothers and nurses to suckle and bathe and wash the children, but in no ways to prattle or speak with them; for he would have learnt whether they would speak the Hebrew language (which had been the first), or Greek, or Latin, or Arabic, or perchance the tongue of their parents of whom they had been born. But he laboured in vain, for the children could not live without clappings of the hands, and gestures, and gladness of countenance, and blandishments." [3]

Several centuries after Frederick II's experiment, James V of Scotland sent two children to be raised by a mute woman in a specially-constructed cabin, to determine if language was learned or innate. The children were reported to have spoken good Hebrew.[4] This experiment was later repeated by the Mughal emperor Akbar, who held that speech arose from hearing, thus children raised without hearing human speech would become mute.[5]
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 15 Jul 2008, 05:03
http://www.feralchildren.com (http://www.feralchildren.com/en/index.php)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 15 Jul 2008, 08:39
Ah yes, the Steampunk look.  The ornate metalwork is indeed cool and nice to look at, but seems like it'd be distracting.

I'm more into the stateliness of hardwoods:

(http://justinidea.typepad.com/photos/uncategorized/2007/03/18/wood_contour.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 15 Jul 2008, 16:42
Ugh. Something about that repels me. It looks ornate in a bad way.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 16 Jul 2008, 02:32
I think it's that it looks like some computer company exec said to one of his guys "Y'know these steampunk cases are big right now, we could make a lot of money selling a mass market version!"
And his engineering guy basically said "Well, if it's Victorian then it'll be made out of wood, so we'll just make the exact same stuff we usually make but we'll use a fake wood grain plastic."

Basically it looks cheap and nasty.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 16 Jul 2008, 02:52
http://youtube.com/watch?v=ptC9N9YJ24Y
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 16 Jul 2008, 09:08
Goes well with your sigquote.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 16 Jul 2008, 10:52
Wow.  Just... wow. 

That's cherry, a genuine hardwood.  You guys are so used to seeing imitation crap, then when you actually see the real thing, you think it looks cheap and plastic.  It's not shiny because it's plastic; it's varnished and polished.

Whatever.  I'll go take my nap now.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 16 Jul 2008, 11:44
 Yeah GRAMPS. Don't forget your Frank Sinatra records and dentures.

 You know I am kidding and you are actually the awesomest old guy ever, right?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 16 Jul 2008, 12:02
http://youtube.com/watch?v=ptC9N9YJ24Y

omg that song was awesome. Is there a download so I can put it on my iPod?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Plasticity on 16 Jul 2008, 13:30
I would much rather have a hardwood desktop than a steampunk one with a bunch of extraneous knobs and dials. There is a simple elegance to the Cherry that the steampunk lacks.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 16 Jul 2008, 15:08
If they actually move then they give you something to do while you acquire etchings and plates of bare ankles of ladies upon the aether.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 16 Jul 2008, 16:56

omg that song was awesome. Is there a download so I can put it on my iPod?

Not a clue, but if you find it, I want it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: morca007 on 16 Jul 2008, 18:17
Steampunk outside literature is the dumbest shit ever.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 16 Jul 2008, 18:41
if you find it, I want it.

ah so the musician who performed the song is a fellow named Loudon Wainwright. I think it's pretty lame that the description on youtube didn't credit the musician; this post of that video does:
http://video.google.com/videoplay?docid=-2292524727199446242

I mean, it mentions him in the credits at the end, but who's going to see that?

Incidentally, when I read his wikipedia page some of his other songs sound pretty hilarious too:
http://en.wikipedia.org/wiki/Loudon_Wainwright_III

hee hee he wrote a song about his son breastfeeding called "Rufus is a tit man."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 16 Jul 2008, 18:42
(http://img337.imageshack.us/img337/4021/bullshitgg3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 16 Jul 2008, 21:25
here's my fursona guys

(http://img.photobucket.com/albums/v12/sademie/fursona.jpg)
(http://img.photobucket.com/albums/v12/sademie/fursonawapn.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 17 Jul 2008, 01:33
lol whut?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CamusCanDo on 17 Jul 2008, 04:23
"...known to be unpenetratable and unbreakable"

Fuck
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 17 Jul 2008, 08:08
(http://www.geocities.com/jevan_wk/list/comics/lyc_tight.jpg)



Drastic.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: supersheep on 17 Jul 2008, 08:44
How does the giant poisonous multi-winged cat-dragon-bear hold the thirteen-foot-long, four-foot-wide, three ton sword-spike-thing?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 17 Jul 2008, 09:12
can't you read? it's wields itself.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 17 Jul 2008, 10:13
But the text clearly states that Sapph can carry it. This person has clearly not thought through the mechanics.

I mean geez
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: bicostp on 17 Jul 2008, 15:42
Anime Werewolf Thing and the Amazing Technicolor Dreamwhateverthehellthatis!  :-D

"It's out of stainless steel, gems, and gold"
Aw, it ran out of shiny things and precious metals. Oh well, there are far more practical uses for them anyway. (Gold makes crappy weapons anyway.)

"...known to be unpenetratable and unbreakable"

Fuck

Just burn it. It doesn't say anything about it being unburnable.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 17 Jul 2008, 16:04
But wait, those materials wouldn't weigh three tons. I'll bet it's made of Sapphadamantinium.

Plus there should be more spikes on the weapon. Specifically, there should be spikes on the spikes, kind of a fractal thing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 17 Jul 2008, 16:33
Oh god, it is like someone vomited a rainbow
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: supersheep on 17 Jul 2008, 18:14
But it only wields itself when Sapph needs it to be like a partner to her the of touchest of battles.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 17 Jul 2008, 19:20
But wait, those materials wouldn't weigh three tons. I'll bet it's made of Sapphadamantinium.

Plus there should be more spikes on the weapon. Specifically, there should be spikes on the spikes, kind of a fractal thing.

nuh uh stanless steel is much more dense than it's stan-heavy cousin.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 17 Jul 2008, 19:24
(http://img401.imageshack.us/img401/5368/fuckeduptotarofs5.jpg)

(http://img329.imageshack.us/img329/3174/instantdeathandfinezt0.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 18 Jul 2008, 02:27
Wait...
What the....
Do they just take it out of your wallet?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 18 Jul 2008, 03:15
  The woman who voices Pikachu. (http://youtube.com/watch?v=bHk52RvpOLw&feature=related)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 18 Jul 2008, 03:41
*squeeeeeeeeeeee*
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CamusCanDo on 18 Jul 2008, 07:59
First is steampunks (http://www.youtube.com/watch?v=W95z1DqOIUg), and then the real papercraft (http://www.youtube.com/watch?v=e45J0SCXO5s&eurl).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 18 Jul 2008, 09:40
dear god could you sodomise these people.]dear god could you sodomise these people. (http://www.youtube.com/watch?v=f_48BHx6WU8&eurl=http://www.hilavitkutin.com/videoblogi/)

I fucking suck and I don't go back and look at my posts to make sure I didn't fuck up
Oh I like when i talk dirty
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 18 Jul 2008, 09:50
You know that little girl is going to make Talking Jesus in to Barbie's new boyfriend.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 18 Jul 2008, 11:21
edit: never mind
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 18 Jul 2008, 11:48
dear god could you sodomise these people. (http://www.youtube.com/watch?v=f_48BHx6WU8&eurl=http://www.hilavitkutin.com/videoblogi/)

I just realized that my post makes no sense unless you can get to the video Dollface was trying to link, so I fixed the code.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 18 Jul 2008, 13:38
(http://img369.imageshack.us/img369/751/wordheroqk3.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Jul 2008, 14:01
Nooooooooooo...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Jul 2008, 14:04
Well yes, you could have chosen a better picture of me. But I feel all appreciated every time you post and I see my smiling face along side it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 18 Jul 2008, 14:12
I can't decide if James Joyce was a genius or just needlessly pretentious and obtuse. Or both. I've tried to properly read Ulysses many times and never got beyond a few pages, despite having a broad familiarity with the whole thing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Jul 2008, 14:23
Jens.

You are making me sad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 18 Jul 2008, 14:29
Where did you get that picture? It is excellent.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Jul 2008, 14:42
Noooo it is the worst. Jens, don't do this to me. Please don't.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Jul 2008, 14:58
Much better. I don't mind most pictures of me with funny facial expressions, but that one is just the worst. Plus, it kinda looks like I have a mullet.

Edit for pointless thing:

(http://www.picturesforsadchildren.com/comics/00000028.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 18 Jul 2008, 20:19
No liz, you don't look like you have a mullet, but rather just a character from a Wallace and Gromit episode.


(http://www.capilanomall.com/images/wallace-gromit.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Jul 2008, 20:51
I see a mullet, that's all I'm sayin'.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 18 Jul 2008, 21:12
(http://img515.imageshack.us/img515/4217/britishpoohxz2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: muteKi on 18 Jul 2008, 23:58
Brawl machinima:

http://www.youtube.com/watch?v=hyU9-GreWFg

http://www.youtube.com/watch?v=N0dsKDAMd8Q

http://www.youtube.com/watch?v=lGvKbGP1Fxk
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 19 Jul 2008, 03:44
 Those were pretty hilarious.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 19 Jul 2008, 20:28
I'm so glad I watched the second one all the way through. I was tempted to stop because it started out dumb, but for whatever reason I kept watching and the ending is hilarious.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 20 Jul 2008, 19:08
(http://www.photobasement.com/wp-content/uploads/2008/07/furryhomeschool.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 20 Jul 2008, 19:09
Is... is that for real?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 20 Jul 2008, 19:47
*ahem* (http://defenestrate-me.livejournal.com/profile)

EDIT: Can't find proof of actual post though.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 20 Jul 2008, 19:55
(http://img389.imageshack.us/img389/5016/makesnosenseaw0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 21 Jul 2008, 01:12
*ahem* (http://defenestrate-me.livejournal.com/profile)

EDIT: Can't find proof of actual post though.

it was probably deleted by the community.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 21 Jul 2008, 02:38
Pft, stuff like that never happens on the internet
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mat_mantra on 21 Jul 2008, 11:08
*ahem* (http://defenestrate-me.livejournal.com/profile)

EDIT: Can't find proof of actual post though.

it was probably deleted by the community.


Looks like it was deleted, and from the looks of this post a few days later, i don't think it went over too well in the community

http://community.livejournal.com/homeschooling/223930.html
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 21 Jul 2008, 15:39
(http://img.photobucket.com/albums/v12/sademie/LOLOLth.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 21 Jul 2008, 17:11
(http://image.idlethreat.com/gallery/images/corinthians_tramp_stamp.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 21 Jul 2008, 18:03
 That is quite some long tattoo. Not COMPLETELY ridiculous, though.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Plasticity on 21 Jul 2008, 18:13
http://youtube.com/watch?v=-8BmOQqukRY

Snake.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: morca007 on 21 Jul 2008, 21:01
That is one of the worst tattoos.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 21 Jul 2008, 21:09
I like text passage tattoos, but that is almost the worst place for one.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thlayli on 21 Jul 2008, 21:11
Well... it's better than getting John Lennon's face on a tramp stamp.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 21 Jul 2008, 23:13
SMOKE ME A KIPPER, I'LL BE BACK FOR BREAKFAST!

Even though I know that a kipper is some kind of a food thing, the first thing to pop into my head every time I hear this is
(http://img244.imageshack.us/img244/9671/543191dvlfxn6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 22 Jul 2008, 04:45
Aww, man... you know she's gotta be getting annoyed with guys just stopping mid-task to read her back.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 22 Jul 2008, 06:11
Not to mention all the ironic snickers.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 22 Jul 2008, 09:12
I just figured it was reading material.  Might as well have something to read while you're back there.

"Wait... hold still for a second... what's this word?"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Oli on 22 Jul 2008, 09:25
I can think of better things to read than the bible while you're going at it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 23 Jul 2008, 00:41
http://www.urbandictionary.com/define.php?term=fuck-me+band

lol whut?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 23 Jul 2008, 01:54
Ok, more Steampunk...

'Cause...

Y'know... It's been too long.

http://www.youtube.com/watch?v=5Y4u8sWO1Kk
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: minorbird on 23 Jul 2008, 02:06
http://www.urbandictionary.com/define.php?term=fuck-me+band

lol whut?

These went out of fashion years ago. Or at least I hope they did...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 23 Jul 2008, 02:46
I know that but the whole "fuck-band" idea is totally new to me.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 23 Jul 2008, 07:36
I know that but the whole "fuck-band" idea is totally new to me.

There was a sensationalist news story about it here in the states maybe 4 or 5 years ago.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Yakob on 23 Jul 2008, 08:30
http://youtube.com/watch?v=1gZ0x8AVaBI (http://youtube.com/watch?v=1gZ0x8AVaBI)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 23 Jul 2008, 10:11
(http://img357.imageshack.us/img357/9765/rollps7.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 23 Jul 2008, 13:39
I live in Cambridge, and we seriously have graffiti like that. I saw some the other day that said "Cambridge = Oxford / PI r2". It's great living in a town of nerds.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 23 Jul 2008, 14:33
(http://www.pollsb.com/files/view/49803?1216741155)

This little dude is adorable!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: J-cob9000 on 23 Jul 2008, 14:38
SMOKE ME A KIPPER, I'LL BE BACK FOR BREAKFAST!

Even though I know that a kipper is some kind of a food thing, the first thing to pop into my head every time I hear this is
(http://img244.imageshack.us/img244/9671/543191dvlfxn6.jpg)
DUDE.
my cousin.
at the beach, was watching that. and there was a dolphin on a swingset.
it was like some kind of bad trip or something.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 23 Jul 2008, 15:04
(cute little wormy thing with legs)

This little dude is adorable!

It's an Ajolote.  Pretty neatorama.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 23 Jul 2008, 17:40
(http://img295.imageshack.us/img295/8263/playtherightsongjx2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 24 Jul 2008, 01:49
Yeahhhh

wait what

(http://a125.ac-images.myspacecdn.com/images01/74/l_a6ceb80ec71b00b216903ba37dce6cfc.gif)

(http://upload.wikimedia.org/wikipedia/en/e/e0/XYCoordinates.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 24 Jul 2008, 01:54
The doppler effect is very gay.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 24 Jul 2008, 03:43
The doppler effect is very gay.

Yay rainbows!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 24 Jul 2008, 05:46
I live in Cambridge, and we seriously have graffiti like that. I saw some the other day that said "Cambridge = Oxford / PI r2". It's great living in a town of nerds.

Where did you see that Parm? I really want to go take a look at it now!

And maybe get a couple of photos.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 24 Jul 2008, 10:08
omg street viking dude is dancing perfectly to MSTRKRFT'S "street justice"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 24 Jul 2008, 13:32

(http://www.smbc-comics.com/comics/20070919.gif) (http://"http://www.smbc-comics.com/index.php?db=comics&id=939")

This summed up my day at the library pretty well.

(I actually read the first 4 Harry Potter books one summer when I was bored and I never bothered to read the rest)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 24 Jul 2008, 14:26
I live in Cambridge, and we seriously have graffiti like that. I saw some the other day that said "Cambridge = Oxford / PI r2". It's great living in a town of nerds.

Where did you see that Parm? I really want to go take a look at it now!

And maybe get a couple of photos.

Er, on a boarded up window, somewhere on Magdalene St. Cambridge UK, right? I was going to take a photo, but didn't want to look like a tourist in my own town...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 24 Jul 2008, 16:28
That's why they invented camera phones.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 24 Jul 2008, 20:25
(http://totallylookslike.files.wordpress.com/2008/07/posh-spice.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 25 Jul 2008, 06:36
(I actually read the first 4 Harry Potter books one summer when I was bored and I never bothered to read the rest)

Silly. The last three are fantastic. Also I just re-read the entire series in a week. Whoo!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 25 Jul 2008, 10:55
This came up in another forum, but it is just too good to not shamelessly spam everywhere I can:

NSFW (http://img329.imageshack.us/img329/3193/33c65c91e067f2478b0b6ebmy7.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 25 Jul 2008, 11:19
Stephen Colbert: A True Patriot (http://ccinsider.comedycentral.com/cc_insider/2008/05/stephen-colbe-7.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 25 Jul 2008, 14:28
That's really amazing. Some people...

(http://angryflower.com/schrod.gif)

YOU CAN'T DRINK POSSIBLE BEERS!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 25 Jul 2008, 15:11
(http://farm2.static.flickr.com/1323/1433529629_4c1f775559.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Lunchbox on 25 Jul 2008, 15:22
Man, Bob the Angry Flower was the first webcomic I ever read. Oh, the memories...
(Didn't Loading Ready Run do that strip word for word?)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 25 Jul 2008, 18:36
Stephen Colbert: A True Patriot (http://ccinsider.comedycentral.com/cc_insider/2008/05/stephen-colbe-7.html)

The man is so god damn patriotic, Captain America gave him his shield when he died.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 25 Jul 2008, 19:44
(http://img520.imageshack.us/img520/5310/sciencekd1.png)
(http://img520.imageshack.us/img520/2338/science2kr7.jpg)
(http://img503.imageshack.us/img503/535/science3nz4.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 25 Jul 2008, 21:06
This guy makes some pretty awesome T-Shirts.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 25 Jul 2008, 21:54
I totally want that last one. Do you have a link?*


HEY GAIZ EVERYONE POST IMAGES FROM HERE

http://photobucket.com/images/motivational%20posters/?ref=homepagequad5

IT'LL BE GREAT

http://photobucket.com/images/sarcasm%20or%20sarcastic/?ref=homepagequad3


ADDITION: Well that wasn't hard to find at all

http://wearscience.com/

oh wait this is the "fucking pterodactyls" guy, sweet
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 25 Jul 2008, 22:33
(http://i247.photobucket.com/albums/gg153/SentientToaster/Motivational%20Posters/motivator6542506.jpg)

I LOL'd so hard at this one.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 25 Jul 2008, 22:39
yeah about that, I was kidding
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 25 Jul 2008, 22:55
What are you talking about?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 25 Jul 2008, 23:48
I really want either the dinosaur cloning or the robot and guitar science tee.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 26 Jul 2008, 14:04
Joe I know you were joking but this made me chuckle.
(http://i192.photobucket.com/albums/z273/dokepengin/Posters/Hunt1.jpg)

Also, guys, dancing leads to sex. Shit.
(http://img340.imageshack.us/img340/3262/19672621tj3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 26 Jul 2008, 21:16
That guy does not look serious.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 27 Jul 2008, 10:30
Its always the ones that dont look serious that are.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: supersheep on 27 Jul 2008, 10:50
He's right though. Dancing often leads to sex. This is a good thing, though.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 27 Jul 2008, 11:19
Those guys really need to watch 'Footloose'.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 27 Jul 2008, 15:18
How can you take anyone seriously when they have the so-stereotypical-it's-cliche glasses held together by tape?

He's right, though.  Dancing leads to sex.  Sex leads to babies.  Babies lead to The Dark Side.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Oli on 27 Jul 2008, 16:26
He is carrying a book though. He is clearly an intellectual!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 27 Jul 2008, 17:42
(http://farm4.static.flickr.com/3049/2708717420_3f377ff4ba.jpg?v=0)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 27 Jul 2008, 17:55
WHY IS THERE SO MUCH TALK IN HERE?

(http://img.photobucket.com/albums/v663/Lapuz/dumblevold.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 27 Jul 2008, 18:11
(http://img.photobucket.com/albums/v12/sademie/iichan20080713182849pa3.jpg)

this is original content here, it's a solitaire deal i got.
(http://img.photobucket.com/albums/v12/sademie/worstsolitairedealever.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 27 Jul 2008, 18:12
(http://img253.imageshack.us/img253/8706/areyouji2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 27 Jul 2008, 22:49
(http://www.pretentiousgamer.com/photos/disease.JPG)

ORIGINAL CONTENT

I just bought that this weekend to put on my wall.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 28 Jul 2008, 02:13
Stephen Colbert: A True Patriot (http://ccinsider.comedycentral.com/cc_insider/2008/05/stephen-colbe-7.html)

The best part about this is that they think that people are wrong when they say Stephen is mocking right-wingers--they insist that it's how he actually thinks.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 28 Jul 2008, 13:58
Googling your own name can be dangerous (yes, I did have a good reason to do it).  This what I found; oh dear...

http://www.youtube.com/watch?v=zJO-g-7FdIA (http://www.youtube.com/watch?v=zJO-g-7FdIA)

I promise that's not me.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 28 Jul 2008, 14:08
He's wearing hanbok! (http://en.wikipedia.org/wiki/Hanbok)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 28 Jul 2008, 19:06
(http://img401.imageshack.us/img401/3190/babycentapedeiw4.jpg)

(http://img70.imageshack.us/img70/3199/oldschooliw9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 29 Jul 2008, 01:03
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/20061020batmanVsWolverine.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/456px-Ytv_hi_rocketpower_02-1.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/B26Bfighting.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/bedlamart1vv3.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/Character_drteeth.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/Drteethsketch.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/kill.png)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/Kill-Bill.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/meyoutheshocker.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/Naked-bros-band-cast.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/pointless.jpg)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/sougaelle7.jpg)

(http://upload.wikimedia.org/wikipedia/commons/b/b9/Obesity6.JPG)
(http://i283.photobucket.com/albums/kk289/beastxbeast/random%20images/test.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Lunchbox on 29 Jul 2008, 02:46
Oh man, pointless thread.

(http://i109.photobucket.com/albums/n48/jetrat_22/Uhm/theawefultruth.jpg)

(http://www.riemurasia.net/jylppy/albumit/mmedia/gf/riz/oitp/51911/379471936.gif)

(http://img185.imageshack.us/img185/8853/net02do5.gif)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 29 Jul 2008, 19:19
continuing the King of Hyrule is a jerk thing.....well ending it
(http://www.peachifruit.com/hiimdaisy/kingisajerk4.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 29 Jul 2008, 19:21
At work last night some guy came up and asked me how tall I am, I told him I'm 5'10. He called me a liar and said I have to be a giant because I was taller than him and he's 6 even, I lolled and promised him I'm only 5'10 I just appeared taller because I was on a platform. Best night at work ever.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 29 Jul 2008, 19:40
Quote from: beast
stuff

I wasn't aware that it was possible to "fail" at the Pointless Thread, but I think you may have accomplished it. As far as I'm aware, there's suppsoed to be some sort of comedic value to what's posted. A random Mars Volta album cover is a little bit too pointless, even for the Pointless thread.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 29 Jul 2008, 22:35
Quote from: beast
stuff

I wasn't aware that it was possible to "fail" at the Pointless Thread, but I think you may have accomplished it. As far as I'm aware, there's suppsoed to be some sort of comedic value to what's posted. A random Mars Volta album cover is a little bit too pointless, even for the Pointless thread. I hate black people.

So what you're saying is
(http://i283.photobucket.com/albums/kk289/beastxbeast/572091530lzt2.gif)

but what I'm thinking is
(http://i283.photobucket.com/albums/kk289/beastxbeast/attemptingtogiveadamn4mf.jpg)

I wasn't aware you were an asshole, but I think you may have accomplished it. As far as I'm aware, I can post whatever the hell I want in the Pointless thread. But go  ahead, bitch if you want. From what I've seen, you haven't contributed shit to this thread. If you ever do contribute, maybe I should shit all over what you post. Would you like that?

(http://i283.photobucket.com/albums/kk289/beastxbeast/derkaday6flags.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 29 Jul 2008, 22:41
Be calm! We're here for fun!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 29 Jul 2008, 23:31
We're here for fun, but RedLion is right-ish.  Beast, please don't just use this thread as an image dump.  It's called the "Pointless" thread, but it's evolved into a place where people share amusing things with each other.  If you took the time to read through the thread you'd probably have realised that.

Also, when a member who's been around for a while gives you a tip that you're "doing it wrong" you probably shouldn't reply in an insulting fashion.  You aren't exactly going to endear yourself to the regulars if you are abusive and rude.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 29 Jul 2008, 23:45
I apologize; it just pisses me off when assholes act like they're better than me, especially when they haven't contributed anything. He easily could have been polite about it. But I'll respect your advice.

(http://i283.photobucket.com/albums/kk289/beastxbeast/ug0f0759-66d.gif)
(http://i283.photobucket.com/albums/kk289/beastxbeast/swallows.gif)
(http://i283.photobucket.com/albums/kk289/beastxbeast/2008819209_0d49292b43_o.gif)
(http://i283.photobucket.com/albums/kk289/beastxbeast/purpledrank.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 29 Jul 2008, 23:51
 I love Internet Tough Guys.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 30 Jul 2008, 00:06
Man, I am gonna have to ban this dude in about a week, I can just see it now.

Fucking hell.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 30 Jul 2008, 00:13
Sure...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 30 Jul 2008, 00:22
The people who you say "haven't contributed anything" have contributed a hell of a lot better things to this forum than you have.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 30 Jul 2008, 00:26
(http://i33.tinypic.com/2e1x6de.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 30 Jul 2008, 00:36
The people who you say "haven't contributed anything" have contributed a hell of a lot better things to this forum than you have.

Was I talking to you?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 30 Jul 2008, 00:45
Yes, because that's how public forums work.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 30 Jul 2008, 00:49
It was just a normal night in the bar. The regulars were filtering in and out, nothing too batshit going on. Tommydski had cornered some unlucky and quite sloshed trollop and was charming her with stories of Sloan. She wasn't paying much attention but was entranced by his accent enough to go home with him a bit later on. Suddenly, a young man, 16 with a newly acquired fake ID burst in, acting just a bit too arrogant in his manner to have any real experience with alcohol. This boy, this Beast, sauntered up to the barkeep and loudly proclaimed a litany of boorish and obnoxious statements, as though he were already drunk, though he'd not seen a drop. The bar recoiled in disgust at the interloper. A quiet young man sitting nearby informed him that he was beign rude and obnoxious and to tone it down. In response, the Beast puffed his chest and shoved RedLion back, laughing derisively, mocking him.

not_r0bert_b0yle walked up to the man, telling him to back off. The Beast looked at him and sneered, "Was I talking to you?" The bouncer stepped in pushing b0yle aside to escort Beast from the building. As he was ejected, he laughed loudly that he had won, that he had gotten kicked out, just like he wanted. He had won.

As he laughed loudest, walking to the next bar, he knew the truth. In those empty streets, there was no victory, just the cold echo of his laughter, laughing back at him.

(No srsly, it'd be cool to ban now.)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 30 Jul 2008, 00:51
(http://i28.photobucket.com/albums/c213/hey_there_fatty/internettoughguymag1pl.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 30 Jul 2008, 00:56
pwhdoges, n0t_r0bert_b0yle!!, est, and Ozymandias, please stay out of this. None of this has been directed towards you in anyway, so I don't understand why you're trying to be involved. I would prefer this not to escalate any further than it already has, so let's all just stop now. this is an internet forum, a pathetic place to prove how tough you are... just stop now.

there, I tried.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 30 Jul 2008, 01:00
this is an internet forum, a pathetic place to prove how tough you are

QFT
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 30 Jul 2008, 01:05
this is an internet forum, a pathetic place to prove how tough you are

QFT

Quoted For Truth, or Quit Fucking Talking?

QWP,S

What?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 30 Jul 2008, 01:06
What?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 30 Jul 2008, 01:06
What?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 30 Jul 2008, 01:07
Wat Tyler
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 30 Jul 2008, 01:09
Somebody deleted their post
:o
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 30 Jul 2008, 01:09
Who?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 30 Jul 2008, 01:25
My dog likes to roll in dead fish:

(http://www.zen60863.zen.co.uk/images/DeadFish.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 30 Jul 2008, 01:27
(http://i283.photobucket.com/albums/kk289/beastxbeast/bitchassness.jpg)
? ? ?
who?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 30 Jul 2008, 01:28
No, Wat Tyler.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: minorbird on 30 Jul 2008, 02:06

Lion's do love men!
 (http://www.youtube.com/watch?v=adYbFQFXG0U&feature=related)

(Don't worry, it's not furrie)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Verergoca on 30 Jul 2008, 02:06
(http://www.gardenofeden.net/lil/failboat.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 30 Jul 2008, 02:32
pwhdoges, n0t_r0bert_b0yle!!, est, and Ozymandias, please stay out of this. None of this has been directed towards you in anyway, so I don't understand why you're trying to be involved. I would prefer this not to escalate any further than it already has, so let's all just stop now. this is an internet forum, a pathetic place to prove how tough you are... just stop now.

there, I tried.

you.


quit fucking up my beloved forum.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 30 Jul 2008, 02:53
...Okay
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Slick on 30 Jul 2008, 03:09
Tommydski had cornered some unlucky and quite sloshed trollop and was charming her with stories of Sloan.

By the way I once played pictionary with Chris Murphy of Sloan. Also there was a lymeric competition at that party and he was pretty good. He asked me if he should buy real-estate in Labrador, and I said probably not. Good times.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 30 Jul 2008, 04:05
Beast, I am involved in this because it is my job to do so. 

RedLion was being fairly polite to you when he pointed out that your posts were not really in the spirit of the thread and therefore not appreciated.  Don't get so defensive, I am not sure what you saw that got your back up so goddamn much.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 30 Jul 2008, 05:57
This thread needs more Jesus:

(http://www.ship-of-fools.com/gadgets/new/media/jesus_chair.jpg) (http://www.ship-of-fools.com/gadgets/new/media/jesus_football.jpg) (http://www.ship-of-fools.com/gadgets/new/media/jesus_pan.gif)

And at least 5% more Pope:

(http://www.ship-of-fools.com/gadgets/pope/media/pope_caganer.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 30 Jul 2008, 06:40
Beast, I am involved in this because it is my job to do so.

Y'know, you should probably list "moderator" under your username. I mean, that shouldn't matter for anyone who spends more than 10 minutes lurking before they start posting, but the people who need to know it are precisely the people who don't spend any time lurking before they start posting.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 30 Jul 2008, 07:12

Lion's do love men!
 (http://www.youtube.com/watch?v=adYbFQFXG0U&feature=related)

(Don't worry, it's not furrie)


Guys, with all this talk going on, you all missed this.

Shame on you.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 30 Jul 2008, 08:05
Quoted For Truth, or Quit Fucking Talking?

Both?

Anyways, we need more pointless images and less talking. Here you go.

(http://www.bigfatwhale.com/archives/bfw_360.png)
(http://trustedplaces.com/blog/wp-content/uploads/2008/07/2689529696_185f5c4603.jpg)
(http://www.getitinwriting.biz/blog/uploaded_images/Check-your-co-workers-773148.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pamplemousse on 30 Jul 2008, 08:54
(http://i.thefairest.info/funniest_thumbs/4Rc96f.jpeg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 30 Jul 2008, 11:06
Beast, I am involved in this because it is my job to do so. 

RedLion was being fairly polite to you when he pointed out that your posts were not really in the spirit of the thread and therefore not appreciated.  Don't get so defensive, I am not sure what you saw that got your back up so goddamn much.

Okay, my bad.
(http://i283.photobucket.com/albums/kk289/beastxbeast/jesus_shocker.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 30 Jul 2008, 12:59
Beast, I am involved in this because it is my job to do so.

Y'know, you should probably list "moderator" under your username. I mean, that shouldn't matter for anyone who spends more than 10 minutes lurking before they start posting, but the people who need to know it are precisely the people who don't spend any time lurking before they start posting.

Est: QC Forums Gestapo.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 30 Jul 2008, 15:19
The Gestapo was official secret police of Nazi Germany.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 30 Jul 2008, 18:08
Y'know, you should probably list "moderator" under your username. I mean, that shouldn't matter for anyone who spends more than 10 minutes lurking before they start posting, but the people who need to know it are precisely the people who don't spend any time lurking before they start posting.

This is a good idea.  I considered doing it last night when all this was going down, but I didn't know if it was a knee-jerk reaction or what.  I was pretty cranky in general yesterday afternoon & while I did yell a bit I didn't really want to go overboard.

You are right, though.  Especially with the apparent influx of new people I should probably just revert back to the default title for a while.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 30 Jul 2008, 18:24
(http://img128.imageshack.us/img128/7958/crimsonvirusqw0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: negative creep on 30 Jul 2008, 18:34
[worker dead at desk for five days]

That is just sad. Really.

here's a funny thing:
(http://lolz247.com/wp-content/uploads/2008/07/emoteen.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blankfile on 30 Jul 2008, 20:03
(http://img291.imageshack.us/img291/5354/catrc8.th.jpg) (http://img291.imageshack.us/my.php?image=catrc8.jpg)

My cat! Have you seen it?

I was too busy watching that new awesome movie to take care of him in his box :(

(http://img292.imageshack.us/img292/6623/1212554442909hm5.th.jpg) (http://img292.imageshack.us/my.php?image=1212554442909hm5.jpg)

Phillip J. Cloud is kicking some serious ass!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 30 Jul 2008, 20:19
(http://www.pretentiousgamer.com/photos/26456196.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 30 Jul 2008, 22:34
(http://images.encyclopediadramatica.com/images/thumb/6/6d/Digglet_underground.JPG/610px-Digglet_underground.JPG)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 31 Jul 2008, 00:56
Huh. I guess I missed some goings-on in this thread.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 31 Jul 2008, 03:29
(http://i28.photobucket.com/albums/c213/hey_there_fatty/sharks.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 31 Jul 2008, 03:32
(http://kensingtonvictoria.com/image001.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 31 Jul 2008, 03:39
Thomas Edison Presents:


PENCILFAAACE.

http://www.youtube.com/watch?v=4MjTb5A68VA (http://www.youtube.com/watch?v=4MjTb5A68VA)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 31 Jul 2008, 03:48
Holy smokes those videos are awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 31 Jul 2008, 06:46
trip on sandals

This is totally something I would do.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caspian on 31 Jul 2008, 06:57
guys,

http://www.e-mancipate.net/
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 31 Jul 2008, 16:18
(http://img.photobucket.com/albums/v619/ackblom12/tennisballhaircut-innovativeorweird.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 31 Jul 2008, 20:15
(http://www.winterson.com.nyud.net:8090/pics/sw053ab.jpg)

Please enjoy the rest of the funny here. (http://winterson.com/2005/06/episode-iii-backstroke-of-west.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 31 Jul 2008, 20:48
(http://img337.imageshack.us/img337/3238/peepkillrobinfm4.png)

(http://img337.imageshack.us/img337/9966/peepshotbarabarajv2.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 01 Aug 2008, 10:08
(http://www.marcofolio.net/images/stories/fun/imagedump/imgdmp_0803_2/march_08_2_37.jpg)

(http://www.marcofolio.net/images/stories/fun/imagedump/imgdmp_0803_2/march_08_2_46.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wolf on 01 Aug 2008, 11:22

(http://slog.thestranger.com/files/2008/07/cinemagic.jpg)

movie theater in portland oregon changing from Hancock to the dark night.

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MrSteevo on 01 Aug 2008, 12:06
(http://healthcare.zdnet.com/images/spanish_inq.jpg)
Bet you weren't expecting that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 01 Aug 2008, 12:28
This is more like it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 01 Aug 2008, 15:24
Dude, please don't post for just a little while longer.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 01 Aug 2008, 15:46
What?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 01 Aug 2008, 15:50
You ruined it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 01 Aug 2008, 16:08
Your post count was 666, which worked perfectly at that point (the description said "HAIL SATAN", or something like).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CardinalFang on 01 Aug 2008, 17:29
Somebody here order a Comfy Chair?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 01 Aug 2008, 18:08
Dude, please don't post for just a little while longer.

It probably would have been more effective to explain about the postcount/title, rather than essentially saying "shut up."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 01 Aug 2008, 18:12
Yeah that was kinda rude

http://www.youtube.com/watch?v=_ZU87L3Vc7M
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tommydski on 01 Aug 2008, 20:36
By the way I once played pictionary with Chris Murphy of Sloan. Also there was a lymeric competition at that party and he was pretty good. He asked me if he should buy real-estate in Labrador, and I said probably not. Good times.

Wait, is that true?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 01 Aug 2008, 21:22
I'm sorry, but this shit (http://www.collegehumor.com/video:1825193) was hilarious
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 01 Aug 2008, 21:55
Does it make me a bad person if I was rooting for the yellow line at the end?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Slick on 01 Aug 2008, 22:48
By the way I once played pictionary with Chris Murphy of Sloan. Also there was a lymeric competition at that party and he was pretty good. He asked me if he should buy real-estate in Labrador, and I said probably not. Good times.

Wait, is that true?

Fairly certain.
He is/was dating someone who danced with my aunt (she is a dancer/choreographer) and it was a pre-production party for one of their shows.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 01 Aug 2008, 23:00
i photoshopped From Hell.

(http://img.photobucket.com/albums/v12/sademie/fromhellshop2.jpg)

alternative ending:
(http://img.photobucket.com/albums/v12/sademie/fromhellshop3.jpg)

another, NSFW (http://img.photobucket.com/albums/v12/sademie/fromhellshop1.jpg)

the original, make your own.
(http://img.photobucket.com/albums/v12/sademie/fromhellshop.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 01 Aug 2008, 23:55
awesome powers, I wish I had them.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 02 Aug 2008, 00:01
if you've got photoshop, it's really really easy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 02 Aug 2008, 00:08
I mean like super powers. I probably should have worded that better.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 02 Aug 2008, 15:05
Not gonna' put the picture here, but just the link, as Troll inspired the photoshopper in me.

http://img.photobucket.com/albums/v438/FocusFlame/Untitled-123.png (http://img.photobucket.com/albums/v438/FocusFlame/Untitled-123.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 02 Aug 2008, 20:12
(http://img293.imageshack.us/img293/8526/fightinabearqh8.jpg)

(http://img369.imageshack.us/img369/4038/fightinabear2oe4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 02 Aug 2008, 20:15
Holy shit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 02 Aug 2008, 22:32
What the hay is going on?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 03 Aug 2008, 01:29
she has man hands!


there was a thread about crummy villains on /tg/, my favorite was MANTIKE

he is a big hairy burly man and has the ability to, at will, become 25 toddlers (ages 3-5)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 03 Aug 2008, 16:09
(http://photos-f.ak.facebook.com/photos-ak-sf2p/v299/150/99/517490392/n517490392_3733157_729.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 03 Aug 2008, 20:37
(http://www.shriiimp.com/im/albums/userpics/13255/IMG_0939.JPG)


SHRIIMP. Obviously nsfw (http://www.shriiimp.com/im/index.php)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thlayli on 03 Aug 2008, 21:03
Man, I am gonna waste the next week on that site. I wish I could paint like that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 04 Aug 2008, 14:50
(http://i278.photobucket.com/albums/kk92/_beatingheartsbaby/drew_anopenlettertosubway.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 04 Aug 2008, 15:14
I just wanna say, that when I worked at Subway, I -always- put the cheese on like that (for coverage). Overlapping it seemed stupid, so I never did. I also never counted out olives for people either. Pfft.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 04 Aug 2008, 17:18
People count the olives? Why? If it's to make sure people aren't getting too many, man that would piss me off so hard. I love olives. When I'm at sandwich shops I generally ask for more olives after the first pass. The way I figure, I didn't ask for much else so you better damn gimme all the olives I want.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 04 Aug 2008, 17:27
If you make food as part of your job, part of your training to being told to count and weigh everything.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 04 Aug 2008, 17:46
Lucky bastard.  At my sandwich shop job everything was by the book.  They kept telling us how many onions we could but on, how high the sprouts should go (we were told to measure them with a fucking knife), and how many peppers should go on the sandwich.  Hell, I got fired for using the mayo spreader first instead of the may scoop.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 04 Aug 2008, 18:03
hey, Jens will you make a peanut-butter and bacon sandwich and see how many people buy one?



....i'd totally buy one.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 04 Aug 2008, 18:08
At my work (which admittedly isn't a sandwich shop) I am sometimes known, or joked about, as the "sandwich boy".

As in, other staff members go home to sleep, or go out to get drunk or do drugs, I go home and make a DAMNED GOOD SANDWICH.
I also like experimenting, like with my vegetarian fajita sandwich I pasted on here a little while back, and my secret wish to be the first to somehow perfect a soup sandwich.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 04 Aug 2008, 18:10
hey, Jens will you make a peanut-butter and bacon sandwich and see how many people buy one?

Yeah that actually sounds kinda tasty. I kinda wish I had bacon right now...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 04 Aug 2008, 18:15
(http://img517.imageshack.us/img517/461/harleyquinnqc7.jpg)

(http://img379.imageshack.us/img379/1485/harleyug4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 04 Aug 2008, 18:15
They kept telling us how many onions we could but on, how high the sprouts should go (we were told to measure them with a fucking knife), and how many peppers should go on the sandwich.

This is retarded. And anyway, does all this stupid beancounting (literally!) take into account customers like me, who have no interest in any toppings other than a huge mound of olives?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thlayli on 04 Aug 2008, 18:19
Man, I love Harley Quinn so much. If I was Batman, I would make up excuses to bust her just so I could tie her up in the Batcave. If they do make a movie for her, Zooey Deschanel better get the role.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 04 Aug 2008, 22:47
but what about batmans other lover. (http://images.encyclopediadramatica.com/images/3/30/Joker_and_Batman_.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 04 Aug 2008, 23:08
Oh man...that's kinda hot.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 04 Aug 2008, 23:17
I work at a sub and pizza place and we are supposed to measure everything, but if a customer asks for olives on a sandwich (technically none of our sandwiches come with that option) I'll walk over to the pizza station, grab a decent handful and toss em on there, even when the boss is there (which are the only times we measure anyway). I absolutely hate at subway when I ask for olives on my goddamn sweet onion chicken teryaki (too tired to spell) and the guy literally grabs like 8 tiny olive slices. Black olives don't have a huge amount of flavor to begin with, so you need more, but I could barely see the ones the motherfucker put on there. Most of the time I have to ask them to add extra like 3 times before they finally put a decent amount on there. fuckers.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: I is Grammar on 04 Aug 2008, 23:32
When I worked at Subway, I always gave a significant amount of olives when people asked for them.  I am deathly allergic to them, so it always grossed me out.  After work every day, I'd have to load up on Benadryl. 
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 05 Aug 2008, 07:20
Olives are gross.

(http://i28.photobucket.com/albums/c213/hey_there_fatty/Olivesaregross.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Lines on 05 Aug 2008, 07:32
Agreed!

I worked at a pizza place in high school and I would get yelled at if I put too many toppings or too much cheese on a pizza. One of my managers would actually scrape some off (but she was a bitch). Same manager would also tell us to not put as many toppings on large orders of pizza, like for a school or church, because they got a discount and "weren't making us money anyways." It was a freaking chain. I hated working there. I also hated going home and smelling like uncooked toppings.

Speaking of pizza...

(http://www.ladyofthecake.com/mel/space/images/pizzahut.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 05 Aug 2008, 07:59
Everyone is complaining about subway...

I ask for a very little bit of lite mayo on my sub and almost every time they squirt out like a half a cup of the stuff on my sub.

I also ask for vinegar and they put the tiniest amount possible on.

Only one subway sandwich artist actually got it right.  So I know those guys can do it if they try.

(I worked at a deli and sub shop and I never skimped on toppings)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 05 Aug 2008, 11:28
Subway formula goes as so, for a foot long sub:
6 oz. (or a small handful) of lettuce (I think)
6 tomatoes (when in season or small in size, otherwise my shop was more like 4-5)
6 pickles
6 olives
3 pepper slices (broken in half, so 6)
6 of the "optional" banana peppers, jalapeos...

And I feel like there is something I am forgetting, but damned if I know what it is. Frankly, all I ever get on my subs is lettuce and tomato...
I always got complimented on my sandwich making abilities by customers and my co-workers. My manager was very upset when I told her I was quitting due to school --but, I got a shoe-in job at another store, which only lasted two months because I hated it sooooo much. A friend of mine made the same school move when she finished high school and was never offered the same opportunity.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Lines on 05 Aug 2008, 11:34
6 olives on one footlong? That's just dumb. Really really dumb.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 05 Aug 2008, 11:42
My Subway puts a lot of whatever you want on your sandwich for no additional cost.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 05 Aug 2008, 11:57
(http://i4.photobucket.com/albums/y120/jhocking/olives.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 05 Aug 2008, 12:02
That is so '90s, Joe.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 05 Aug 2008, 16:34
(http://img413.imageshack.us/img413/460/aladdinfq4.jpg)

(http://img125.imageshack.us/img125/7862/poorstarkub9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 05 Aug 2008, 20:11
Man, when I was a little kid, I was allergic to so many different kinds of food. Dairy, gluten, wheat, a certain kind of protein found in meat... for the first year or so of my life I lived on an IV (fun fact: a few years ago, a doctor told me that if I had been born just 4 years earlier, I would have died.) Eventually I outgrew all of those things. But for a year, between the time when I could only live on an IV, and when I was able to start eating soy, wheat and gluten, olives were one of the few things I could eat. Every time my family went to a restaurant, I would just get...a bowl of olives.

I guess what I'm saying is, I fucking love olives. Especially green ones.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 05 Aug 2008, 22:25
Do not watch this. (http://www.uniquedaily.com/evil-mister-rogers/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 05 Aug 2008, 23:00
 See, I never knew why anybody ever thought Mr. Rodgers was creepy. Everybody thinks he is creepy, and I don't see it! I guess maybe in that video, but it is, of course, mocked up.

 If we are talking about scary videos, watch this (http://www.youtube.com/watch?v=D76ezzF988s).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 06 Aug 2008, 04:00
(http://photos-650.ll.facebook.com/photos-ll-sf2p/v217/0/101/841520650/n841520650_3740746_6432.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 06 Aug 2008, 06:40
Eggs (http://www.iloveegg.com/egg_english.htm)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 06 Aug 2008, 19:20
In their defense, eggs are fucking awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 06 Aug 2008, 22:25
oodle doodle?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 06 Aug 2008, 22:49
Noodels doodels!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 06 Aug 2008, 23:11
Those eggs always make me happy when I need it. I love those little guys.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 06 Aug 2008, 23:29
"Come into my tummy. Oh so very yummy."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 07 Aug 2008, 01:56
(http://www.radaronline.com/features//images/2006/12/atomic-energy-lab-01.jpg)

Other fun toys that your baby should have (http://www.radaronline.com/features/2006/12/toys.php)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Yakob on 07 Aug 2008, 07:20
Kids are pretty stupid.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ImRonBurgundy? on 07 Aug 2008, 10:06
Condoms

Yikes, that's pretty disturbing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Lummer on 07 Aug 2008, 10:10
The bottle of vodka in the background, makes me think this kid might be a bit unfortunate, in the "Parents" department. A damn shame :(
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 07 Aug 2008, 21:34
I got some guy's number at work yesterday. He came in and we talked about guns because he was carrying and it was slow so he gave me his number and said he wanted to take me out "shooting". It was amusing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 07 Aug 2008, 23:16
 Are you looking for the blog thread?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 08 Aug 2008, 03:39
I got some guy's number at work yesterday. He came in and we talked about guns because he was carrying and it was slow so he gave me his number and said he wanted to take me out "shooting". It was amusing.

That sir, is very amusing. :wink:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 08 Aug 2008, 11:21
condoms
I literally just spit soda all over my keyboard on seeing this. It's probably the first time something has made me laugh like this.

I guess I'm just lucky that I don't check this thread while drinking (soda).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: NarwhalSunshine on 08 Aug 2008, 20:56
Are you looking for the blog thread?
nope
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 09 Aug 2008, 17:38
(http://img245.imageshack.us/img245/5513/thosearemyshoesqo2.jpg)

why do dogs attack mailmen?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 09 Aug 2008, 18:14
They attack people they aren't familiar with, and the mailman is the main stranger who comes to the door.

Wait, was I supposed to answer that?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 09 Aug 2008, 20:28
(http://img292.imageshack.us/img292/9109/stupiddogbe6.jpg)

(http://img292.imageshack.us/img292/7677/whatareyoulookingathl1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 11 Aug 2008, 15:45
internet safety (http://darkmonkey.org.uk/4/1/Internet_Safety_Guidelines.jpg).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 12 Aug 2008, 09:01
Man, I love Harley Quinn so much. If I was Batman, I would make up excuses to bust her just so I could tie her up in the Batcave. If they do make a movie for her, Zooey Deschanel better get the role.

this is a good porn storyline
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 12 Aug 2008, 14:39
NOT SAFE FOR WORK AT ALL IF YOU ARE AT WORK OR NEXT TO YOUR 90 YEAR OLD GRANDMOTHER DO NOT CLICK (http://www.ghastlycomic.com/d/20080809.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 12 Aug 2008, 18:36
Ghastly's comic is so awesome

oh man, I haven't read it in ages and the art's gotten a bit better
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 12 Aug 2008, 19:26
(http://img.photobucket.com/albums/v12/sademie/itsbecuzimdeadfagt.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 12 Aug 2008, 19:29
(http://img.photobucket.com/albums/v12/sademie/Heretics.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 12 Aug 2008, 20:10
man, I miss Ghastly.  One of the first webcomics I ever read.

(http://img183.imageshack.us/img183/5476/ididdc1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leinad on 12 Aug 2008, 20:13
disregard that i suck cocks

you say it like it doesn't turn you on
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 13 Aug 2008, 01:15
NOT SAFE FOR WORK AT ALL IF YOU ARE AT WORK OR NEXT TO YOUR 90 YEAR OLD GRANDMOTHER DO NOT CLICK (http://www.ghastlycomic.com/d/20080809.html)

1) You're not wrong
2) I lol'd
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 13 Aug 2008, 02:53
NOT SAFE FOR WORK AT ALL IF YOU ARE AT WORK OR NEXT TO YOUR 90 YEAR OLD GRANDMOTHER DO NOT CLICK (http://www.ghastlycomic.com/d/20080809.html)

My grandma enjoyed it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ViolentDove on 13 Aug 2008, 18:26
I just wanted to post this picture of a naked mole rat.

(http://upload.wikimedia.org/wikipedia/commons/thumb/0/02/Nacktmull.jpg/800px-Nacktmull.jpg)

That is all.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 13 Aug 2008, 18:36
Jesus fucking Christ, what is evolution's problem
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 13 Aug 2008, 18:37
This is a great page break. Well done, est.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 13 Aug 2008, 19:20
Quote
Dear Mr. Prime,
We have received your accident-claims report for the month of June -- they total 27.  I regret to inform you that GEICO will not be able to reimburse you for any of those repairs.  I feel that I have sent the same letter to you once a month for the last 6 months, and I am now sending it again.

Since becoming a GEICO customer in January of this year, you have reported 131 accidents, requesting reimbursement for repairs necessitated by each one.  You have claimed not to be responsible in any of them, usually listing the cause of the accident as either, "Sneak attack by Decepticons," or, "Unavoidable damage caused by protecting freedom for all sentient beings."

The only repairs for which you are reimbursed were the replacement of a cracked fender and a headlight, required after a Mr. I. Ron Hide backed his van into your truck;  these cost $1,286.63.  Our own investigation concluded that you are not at fault and that Mr. Hide had been drinking prior to the accident.  Thought police where unable to test his blood-alcohol level -- Mr. Hide explained it would be impossible for police to examine his blood-alcohol content with a breathalyzer, because he, "Doesn't breath" -- under Washington State law, refusal to take a breathalyzer test is equivalent to returning a result above the legal level.

But I repeat, those were the only repairs for which you have been reimbursed, and it was a very minor accident in comparison to your other claims.  I mention a few to illustrate the trend:

*$379,431.34 requested reimbursement to your truck cabin.  You claimed the damage was caused by attacking fighter jets

*$665,789.11 requested reimbursement for repairs to your trailer.  You claimed this damage was caused by a giant, mechanical scorpion, which I can only assume is some amusement-park ride, although I question the wisdom of bringing your mobile home so close to such dangerous equipment.

*$6,564,239.44  requested reimbursement for repairs to a truck part called the, "Autobot Matrix of Leadership."  You stated this occurred in, "an ultimate confrontation between good and evil," with a Ms. Meg Atron and a Mr. U. Nicron causing the damage in question.  Mr. Prime, I have checked every known car and truck part catalog published in the United States and have found nothing even resembling that part, never mind any part that expensive.  Whatever disagreements you had with Ms. Atron and Mr. Nicron, I suggest that next time you settle things peaceably or leave your Autobot Matrix of Leadership at home so it does not break.  GEICO does not cover Autobot Matrix of Leaderships.

And the list goes on.  Mr. Prime, I am going to remind you again:  Your policy with GEICO only reimburses you for accidents that occur while you are engaged in reasonable use of your truck and trailer.  As I told you when you originally purchased the policy, GEICO does not offer Megatron coverage, Starscream coverage, Decepticon coverage, or Energon-blast coverage.  Those are just not the types of damages we would expect from reasonable use.

To sum up, GEICO has been unable to reimburse you for any repairs, but due to the high number of accidents you have been party to this month, combined with the many accidents you have had in the preceding five months, your premium has increased to $235,567.50 per month.  While that may seem like a lot, I remind you that it is a savings of $137 over Progressive and $98 over State Farm.  Please have your check into our main office by the end of July.

Regards,
Simon Furman
GEICO Agent
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 13 Aug 2008, 19:33
I actually did not get the above post until it started talking about Megatron coverage.

In hindsight, it was funnier when I didn't get that it was about Transformers.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 14 Aug 2008, 10:39
Ally!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 14 Aug 2008, 12:21
(http://photos-650.ll.facebook.com/photos-ll-sf2p/v309/0/101/841520650/n841520650_3834584_3693.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tehz on 14 Aug 2008, 13:43
(http://img.photobucket.com/albums/v208/kalnaar_khan/1216471115818-2.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 14 Aug 2008, 13:49
Damn, I missed the pants party.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 14 Aug 2008, 14:39
Watch all the way through, no matter how horrified you are. (http://www.youtube.com/watch?v=bAsXM3L_dnM)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Slick on 14 Aug 2008, 14:56
I watched all the way through and found no good reason to have done so. Maybe it is more funny if you are afraid of transexuals?

I thought it odd that he was using a microphone while using a pre-recorded vocal track, wondering why he'd bother having a useless prop that just gets in the way and serves no purpose.
Then I remember he was a transexual drag queen.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 14 Aug 2008, 15:32
It's more just generally a horrible song, with terrible, explicit lyrics.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 14 Aug 2008, 15:54
This song always makes me SMIIILE. (http://www.youtube.com/watch?v=-bAN7Ts0xBo)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 14 Aug 2008, 16:25
Damn, I missed the pants party.

Yup, it was only $10 too.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 14 Aug 2008, 21:47
This song always makes me SMIIILE. (http://www.youtube.com/watch?v=-bAN7Ts0xBo)


If I could have one wish, it would be for that man singing that song to follow me around for the rest of my life
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 14 Aug 2008, 22:24
I see your transexual felcher fetishist(??), and raise you this guy (http://www.youtube.com/watch?v=fbGkxcY7YFU)

If nothing else, he's at least classier.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 14 Aug 2008, 23:54
This song always makes me SMIIILE. (http://www.youtube.com/watch?v=-bAN7Ts0xBo)


The refrain of that song gets so fucking annoying after about the 2 minute mark. Still, amusing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 15 Aug 2008, 01:58
(http://www.appletreeblog.com/wp-content/2008/03/nader-toothpaste.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 15 Aug 2008, 07:56
(http://photos-d.ak.facebook.com/photos-ak-sf2p/v297/154/94/728475652/n728475652_1088979_823.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 15 Aug 2008, 09:24
Yet another Disney song given the treatment (http://www.collegehumor.com/video:1766438).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 15 Aug 2008, 09:42
(http://img47.imageshack.us/img47/3650/216905095526a0f1ba43oia3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Oli on 15 Aug 2008, 09:44
llamapillar!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 15 Aug 2008, 09:52
It looks like a furry shit with a face.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 15 Aug 2008, 11:51
My avatar approves.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leinad on 15 Aug 2008, 14:26
How has this been hiding from me? (http://www.youtube.com/watch?v=qNfDzfhRgkU&feature=related)

I mean, really... dang.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 15 Aug 2008, 15:17
http://www.fmft.net/archives/BBC_NEWS.htm

Hialrious mental imagery.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 15 Aug 2008, 15:20
but it is (http://www.lionvs40midgets.uk-directory.com)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Aimless on 15 Aug 2008, 15:59
(http://img.photobucket.com/albums/v383/SinWithSebastian/l97wN5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 15 Aug 2008, 22:22
(http://photos-d.ak.facebook.com/photos-ak-sf2p/v297/154/94/728475652/n728475652_1088979_823.jpg)

(http://img166.imageshack.us/img166/6958/zombieattackjt6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 16 Aug 2008, 03:49
(http://photos-h.ak.facebook.com/photos-ak-sf2p/v309/0/101/841520650/n841520650_3845263_4275.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 17 Aug 2008, 02:52
 An a capella group singing "Guy Love" from Scrubs. (http://www.youtube.com/watch?v=9PoW9XuxDJo)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: AngelicHapa on 17 Aug 2008, 03:47
(http://www.christianguitar.org/forums/attachment.php?attachmentid=86788)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 17 Aug 2008, 04:31
How much of a nerd does it make me for finding that really funny?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 17 Aug 2008, 05:06
I think it is pretty funny too.  It is ok.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Aimless on 18 Aug 2008, 03:46
(http://i305.photobucket.com/albums/nn225/megadarra/SETI_gets_a_signalA.jpg)

:'(

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 18 Aug 2008, 09:52
I think it is pretty funny too.  It is ok.

I was hoping for someone cooler to reassure me but you will do. OOOO BURN. Yeah Im bored.

(http://photos-h.ak.facebook.com/photos-ak-snc1/v321/0/101/841520650/n841520650_3870383_7294.jpg)
I can laugh at this guy since Ive done something pretty similar myself. A little less weight on the bar when I did it though.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 18 Aug 2008, 10:36
Oh man, the Syntax error one and the SETI one are awesome!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: sean on 18 Aug 2008, 11:57
This is a pretty good road sign.

(http://farm4.static.flickr.com/3070/2775660282_8a1d04e54f.jpg?v=0)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Edith on 18 Aug 2008, 14:49
Especially where someone wrote "Wee!" like the car is just diving in to cool off.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 18 Aug 2008, 16:00
Fuck I am so glad that sign doesn't have a "FAIL" superimposed over it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: sean on 18 Aug 2008, 16:03
I took that picture myself. I would never do something like that to my photograph.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 18 Aug 2008, 16:20
Splendid
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 18 Aug 2008, 16:28
Don't let it spread around the internet. First it will say "Fail." then "Pwned" and soon it will be a demotivator saying "CAR  Don't drive it off a cliff"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 18 Aug 2008, 16:46
All "FAILCAR IS FAIL"
All "UR DOIN IT RONG"
All "GHOST CAR WILL KILL YOUR FAMILY"
All "ALL YOUR CARS ARE DRIVE OFF A CLIFF"
All "DRIVERLESS CAR DRIVING OFF A TRIANGULAR CLIFF INTO WAVES SIGNIFYING WATER IS DRIVING OFF A TRIANGULAR CLIFF INTO WAVES SIGNIFYING WATER"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tommydski on 18 Aug 2008, 17:36
Sorry I'm late -

(http://i75.photobucket.com/albums/i318/tommydski/Ted1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 18 Aug 2008, 17:42
(http://img169.imageshack.us/img169/5705/brawlinthefamilyyd6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 18 Aug 2008, 17:54
Ok fine

(http://img.photobucket.com/albums/v371/est_xplosif/random/carvscliff-greg.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Aug 2008, 20:15
"Ceiling Cat is watching you masturbate drive off a cliff" with a terrible photoshop hack job.

The only one of these that I actually enjoy is this one (http://wiygn.files.wordpress.com/2007/10/god.jpg?)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 18 Aug 2008, 20:25
The Dark Knight with Kids.

http://www.youtube.com/watch?v=d8LRVgsKsBA
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 18 Aug 2008, 22:33
That was okay (excellent idea, so-so follow through) but this related video is the shit:
http://www.youtube.com/watch?v=w2yv8aT0UFc&feature=related
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ViolentDove on 18 Aug 2008, 22:53
I wrote this today. It's a poem entitled "An Ode to Putative Diguanylate Cyclase"

ATGTTCCCAAAAATAATGAATGATGAAAATTTTTACCGAAAAGCGGTTGAACAGGCGGTAGCGCCGCCTG ACCCTCTTGATGATCGTCAGCGCTCCGGGTTGCGCTTCGCCCGGCGCATCAGGCTACCGCGCGCAGTGGG GTTAGGGGGGATGTTTTTACCGGTGGCCGCCGTGTTAGTGTCGCAACCTGTCTTTGGCGGCTGGTGGCTA TTGCTGGTCGGCTGGTCTTTTGTCTGGCCGCATCTGGCATGGCAGTGGGCGGCGAAAGCCCTTGATCCGC TACGCCAGGAAATTTACAACCTGAAAGTGGATGCGATCCTCTCCGGCATGTGGATCGCGCTGATGGGCGT CAATATGTTGCCTGCCGCCGCGCTGTTTATGATGATGAGCATGAATCTGATGGGCGCTGGCGGGCGGCGG CTATTCACTGTCGGAATGGGCCTTTTGCTGGCGTCATGTCTGGTGACGTTGCAGCTTACCGGGCTACCCG TCGCGATGCGAAGCTCGTCGCTGGAAGTCACGCTCTCTTTGCCCGTCATTATGTTGTATCCGCTTCTGTT CGCCTGGGTAAGTTACCAAACGGCCATTAAATTAGCGGAACATAAGCGACGCTTGCAGGCGATGAGCTCG CGGGATGGCATGACCGGCGTCTATAACCGACGCCACTGGGAAATTTTATTACGTAATGAATTCGATCACA GCCGACGCCACCATCGGGAGGCGACATTGTTGATTATCGATATCGATCATTTTAAGAGCATTAACGACAC CTGGGGACATGATGTTGGGGATGAGGCTATTATCGCCCTGACGCGTCAATTACAGATAACGCTACGCGGG AGTGATATTATCGGGCGCTTTGGCGGCGACGAATTTGCGGTGATTATGTGCGGAACGCCGGCAGACAGCG CGATTACCGCCATGTCGCGAGTGCATGAACGGCTAAATACCTTACGCTTGCCGGGCGCGCCGCAGGTCAT GTTACGTATCAGCGTGGGCGTGGCGCCGTTAACGCCACAAATCGGTCATTATCGGGAATGGCTAAAGTCT GCGGATATGGCGCTTTACAAAGCAAAGAATGCCGGACGTAACCGCACCGAAGTGGCGGCATGA

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 19 Aug 2008, 04:24
Ladies just love this look.


(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/9145.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 19 Aug 2008, 05:34
from a thread about game Griefing:

"One of my favourite things to do when I first found Second Life back in 2006 was to go around and see if I could find type-fuckers. That is, people who use Second Life entirely as a sex substitute to get off.

It wasn't very hard to find someone, especially in those days. All you had to do was simply look for two dots on the map that were very close to each other, and there was about a 70% chance they were e-fucking. Naturally of course, from then on a prank was in order.

What i'd usually do, is jump in a Cadillac and drive straight through the wall of their house mid-coitus. When confronted, i'd be apologetic and tell them "Sorry, I believe I took a wrong turn somewhere" and ask for them directions. I'd needlessy draw the conversation out as long as I could and make it as awkward as possible. Some people would get incredibly mad or embarrassed, standing up outright, others would continue as if I wasn't there and respond in casual conversation back to me."

complete with these awesome images:

(http://img.photobucket.com/albums/v12/sademie/secondlife1.jpg)
(http://img.photobucket.com/albums/v12/sademie/secondlife2.jpg)
(http://img.photobucket.com/albums/v12/sademie/secondlife3.jpg)
(http://img.photobucket.com/albums/v12/sademie/secondlife4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 19 Aug 2008, 08:05
 The hilarious thing is that the person who felt they had to do that was probably almost as pathetic (albeit a little more funny) than the e-fuckers.

 Hilarious pictures though.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 19 Aug 2008, 08:17
Bear Creek Apartments (http://www.radiomaru.com/comics/short/bca/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 19 Aug 2008, 11:48
(http://kuvaton.com/bshit/1218781189120.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 20 Aug 2008, 03:40
Is this shit real? seriously

(http://www.ubergizmo.com/photos/2007/5/dog-walking-game.jpg)
(http://duenos.net/images/alex/DogWalkingVG.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 20 Aug 2008, 03:49
Is it set up on some form of treadmill? If so, I could see where that could promote exercise. Personally, I'd like to be able to occasionally (even as a "lose" condition) be able to release the leash and have my dog maul a random pedestrian. I would totally play that game.

Heh... "Michael Vick's dog walking sim".
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 20 Aug 2008, 03:55
It is as real as this game (http://www.syberpunk.com/cgi-bin/index.pl?page=boonga) in which you score points by jamming a giant plastic finger up a child-molester's ass.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 20 Aug 2008, 04:58
The finger/"fingers of both hands held in a kind of gun shape" poked at someone's bottom thing is called "Kancho" and is basically the Japanese version of the wedgie.  It happens in some other Asian countries too, I think.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 20 Aug 2008, 10:39
A wedgie I can almost understand.  Never given nor received one, and it's not really what I'd call "funny".  But I'm boring that way.

A Kancho however seems like it could get out of hand (so to speak).  I mean, there is potential penetration if done too hard, even through jeans.  At that point, we're beyond harmless silly fun.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 20 Aug 2008, 11:03
It's a thing done mostly by little kids. When I was in Japan as an exchange student, I did student teaching at an elementary school, and half my time there was spent protecting my ass from their tiny, tiny fingers. They thought it was rather hilarious to kancho the gaijin, and actually, it's rather funny when it happens to someone else. They also liked to try and grab my junk, and the other teachers found this to be just as hilarious as the kids did, so they never offered any help. Just sat there and watched the kids try and molest the crazy white guy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leinad on 20 Aug 2008, 11:08
You should have worn electric panties.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 20 Aug 2008, 11:19
If it's little kids, I guess it's mostly harmless and silly.  If you get to 25 and still think it's funny to stick your finger up people's butts... well, I'm sure someone will point out the error of your ways.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scrambled Egg Machine on 20 Aug 2008, 11:19
Not in Japan, they won't.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 20 Aug 2008, 17:03
(http://img395.imageshack.us/img395/4905/chlateryearstb9.jpg)

(http://img395.imageshack.us/img395/1827/dawwfj3.jpg)

(http://img395.imageshack.us/img395/6416/calvinandhobbesfb8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ImRonBurgundy? on 20 Aug 2008, 17:16
Okay, the last one made me laugh.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Storm Rider on 20 Aug 2008, 20:19
It's funny, but man, John Calvin and Thomas Hobbes were kind of assholes.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 20 Aug 2008, 20:24
I am amazed such pessimistic assholes inspired such a great comic
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 21 Aug 2008, 07:57
(http://kuvaton.com/kuvei/this_could_end_bad.jpg)

This could end bad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 21 Aug 2008, 10:27
(http://photos.l3.facebook.com/photos-l3-snc1/v314/45/81/535566231/n535566231_1179614_178.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 21 Aug 2008, 10:35
Jed, that is adorable and sad. The little guy is going to be lunch.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 21 Aug 2008, 11:23
We want to teach you guys something.

http://www.youtube.com/watch?v=eyqUj3PGHv4

It's called YES.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 21 Aug 2008, 11:32
Oh. Em. Gee.

That was hilarious.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 21 Aug 2008, 23:56
(http://kuvaton.com/kuvei/this_could_end_bad.jpg)

This could end bad.

Oh man, the leopard on the left is more or less whispering into the animal's ear "you're fuckin' dead, man."

I feel like that picture was taken .003 seconds before one of those two clamped down on the throat of that...whatever it is.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 22 Aug 2008, 00:22
Now that's fight music (http://www.youtube.com/watch?v=SRyBaR7oB0g)

(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/messedup.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 22 Aug 2008, 06:21
Oh man, the leopard on the left is more or less whispering into the animal's ear "you're fuckin' dead, man."

I feel like that picture was taken .003 seconds before one of those two clamped down on the throat of that...whatever it is.

Guys, why so gruesome? Maybe the leopards are nuzzling up to their friend! Y'know, the lion layeth down with the lamb, that kind of thing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 22 Aug 2008, 06:30
Uh, they're cheetahs, not leopards. See the markings on their faces?

cheetah markings (http://animals.nationalgeographic.com/staticfiles/NGS/Shared/StaticFiles/animals/images/primary/cheetah-closeup.jpg)
leopard markings (http://www.maxwaugh.com/images/tanzania07/leopard2.jpg)


Oh, and for something different

(http://photos-c.ak.facebook.com/photos-ak-sf2p/v298/228/45/522947993/n522947993_1300850_375.jpg)
facepaintiiiiiiiiing
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 22 Aug 2008, 06:32
Thanks to Cheetos, I can no longer recognize cheetahs unless they are bright orange.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 22 Aug 2008, 13:37
Well they're both similar members of the Felidae family, so whatever. Not like I called them a bobcat or something.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 22 Aug 2008, 13:41
nothing new here, just thought i'd remind you all how gross viscera can be.

(http://img136.imageshack.us/img136/8133/whaleblubber6mx.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 22 Aug 2008, 13:45
Gross gross gross.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 22 Aug 2008, 13:46
Whoa, what the...fuck? That's not photoshopped, right?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 22 Aug 2008, 13:48
as far as i know, that is pure and unfiltered photojournalistic goodness/grossness.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Verergoca on 22 Aug 2008, 13:50
Interesting that in fact, the whales body blew up at the spine, i would have expected the belly/underside of it to give in to pressure first...

Why do i think like this?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 22 Aug 2008, 13:55
(http://www.serenadawn.com/Alien-burster.jpg)

it's the only explanation.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tommydski on 22 Aug 2008, 13:58
You could probably hide that behind a link.  :|
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 22 Aug 2008, 14:33
Yeah, yuck.

(http://img.photobucket.com/albums/v515/RobbieOC/mccain_dd.jpg)

ROLL INITIATIVE
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leinad on 22 Aug 2008, 14:44
Dammit I rolled a 2. What happens now?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 22 Aug 2008, 14:46
You are not the VP.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 22 Aug 2008, 16:02
(http://www.hyperdeathbabies.com/anomaly/images/043-gay-bar.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 22 Aug 2008, 16:15
whale guts

That guy does not look happy with what happened to his scooter.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 22 Aug 2008, 20:52
Jed.

I lol'd.

That is a good post.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 22 Aug 2008, 22:46
Oh man I'm totally trying that on a dude tonight.

It will be so awkward.  :mrgreen: :laugh: :-D :-) :-o
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 23 Aug 2008, 08:40
The correct choice of smileys is number 3.

T-rex is always the correct choice.

Also, I thought this was fitting, in case our level of webcest ever escalates.

(http://farm3.static.flickr.com/2206/2450878454_a76112db64.jpg?v=0)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 23 Aug 2008, 14:39
McCain

(http://img183.imageshack.us/img183/2532/iamhopexa5.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 23 Aug 2008, 16:37
whale guts

Which reminds me... (http://www.youtube.com/watch?v=hvha8N3a28U&feature=related)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 23 Aug 2008, 17:11
I saw the title of the video and closed the window immediately.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 23 Aug 2008, 18:34
animated banner

Didn't that used to be Hillary? lame
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 23 Aug 2008, 18:37
I do believe it did

(http://img151.imageshack.us/img151/765/fluffyos1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 24 Aug 2008, 16:31
Which reminds me... (http://www.youtube.com/watch?v=hvha8N3a28U&feature=related)

"reasonable decision, nope can't do that, reasonable decision, nope, nobody wants to, So Dynamite it was"

....I would love to shake the hand of the man that brought that up first.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 24 Aug 2008, 20:42
(http://i137.photobucket.com/albums/q228/andlemonade/IMG00039.jpg)

(http://i137.photobucket.com/albums/q228/andlemonade/photo.jpg)



Both of this pictures were taken on my phone in the wonderful city of St. Louis, MO. You know you guys want to visit. We are completely not hooiser-y or ghetto.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 24 Aug 2008, 22:13
i want a fucking jerky delivery truck RIGHT NOW
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 24 Aug 2008, 22:19
I want to got to a Yar Sale. I think they must sell pirate regalia. Or is that a Yarrrrrr Sale?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 24 Aug 2008, 23:19
We should consult the encyclopedia.
(http://i148.photobucket.com/albums/s5/cystematic/PirateEncyclopedia.jpg)
Mhmm, yes, yes, here it is! It appears that yarr requires a minimum of two r's to be appropriately piratey.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 25 Aug 2008, 03:51
St. Louis is awesome. It invented the Zombie Squad.

There are very few things more awesome in the world than the Zombie Squad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 25 Aug 2008, 10:59
(http://photos-d.ak.facebook.com/photos-ak-snc1/v321/0/101/841520650/n841520650_3930155_4882.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 25 Aug 2008, 11:34
FASCINATING!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 25 Aug 2008, 14:24
After reading the emotional last few pages of Midnight Umbreon's "ba ba da da i need help with my girlfriend" thread, I've decided to apologize to RedLion, est, n0t_r0bert_b0yle!!, and Trollstormur for being an arrogant twat (page 7) . I should have accepted RedLion's criticism as a helpful gesture, but instead I got defensive and pissed off and reacted immaturely. When everyone else got involved, I acted like a dick. I'm sorry.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scrambled Egg Machine on 25 Aug 2008, 14:27
Why is this in the pointless thread?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scrambled Egg Machine on 25 Aug 2008, 14:33
Oh, right. Yes, good job on the apology. Way to be awesome!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 25 Aug 2008, 18:56
He was apologising for page 7 of this thread. Remember that, when there was an argument?

I went through the whole of that girlfriend thread before I realised he meant this thread. Probably why he apologised here.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 26 Aug 2008, 04:47
I'm too much of a nerd. When I see YAR, I think of this:
(http://mathcaddy.com/images/yars_revenge_full.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 26 Aug 2008, 09:36
I may or may not be nerdier than you, depending on which scale you use.  When I see "YAR" I think of:

(http://upload.wikimedia.org/wikipedia/en/thumb/6/6d/TashaYar.jpg/250px-TashaYar.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 26 Aug 2008, 12:50
Video game nerd
Star Trek nerd
(http://www.ribriot.com/wp-content/uploads/samwise-gamgee.jpg)
poh-tay-toh
poh-tah-toh
We're both social rejects.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 27 Aug 2008, 08:45
(http://www.forumsextreme.com/imgs1/aLR_Potatoes.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 27 Aug 2008, 09:49
9001 hours in mspaint

(http://img.photobucket.com/albums/v12/sademie/aLR_Potatoes1.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 27 Aug 2008, 10:04
People need to remember that the internet is visible to everyone.

(http://lh3.ggpht.com/everett6881/RyOQULjfX8I/AAAAAAAABw8/XHrsZcx9lxM/100_0492.jpg?imgmax=640)

Shirts are your friend. Let your friend hug your tender whiteness.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 27 Aug 2008, 10:38
MO NAKED HOES

Oh god, I think this is the first time I've laughed aloud in this thread.

Well done.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 27 Aug 2008, 10:48
that's a shame, there was always several true out-loud laughs to be had in the old Pointless thread...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 27 Aug 2008, 10:51
That was a good pointless thread. It was both hilarious and a colossal time waster.

Did it get locked or deleted?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: iconoclast on 27 Aug 2008, 15:13
(http://content.answers.com/main/content/wp/en/a/a2/Manos-dvd_cover.jpg)

I helped!

You BASTARD! Why did you have to put that back in my mind?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 27 Aug 2008, 18:15
HEY AARON THIS LOOKS LIKE WOOD AND GARY SAYS HE THINKS IT IS WOOD BUT I'M NOT SURE MAYBE IT IS VERMICULITE

(http://img.photobucket.com/albums/v371/est_xplosif/random/YES_IT_IS_WOOD.jpg)

NAW DAWG THAT SHIT IS DEFINITELY WOOD
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 27 Aug 2008, 20:24
I'm bringing sexy back. (http://www.youtube.com/watch?v=81rEuR5niNw)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: I is Grammar on 28 Aug 2008, 10:27
I think my brain melted out of my ears after watching some of that.  Thanks, Ozy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Peet on 28 Aug 2008, 10:31
I CAN TELL THAT THIS IS WOOD FROM SOME OF THE LIGNIN AND FROM HAVING SEEN QUITE A FEW PIECES OF WOOD IN MY TIME.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Patatat on 28 Aug 2008, 10:44
That reminds me of the SNL Will Ferrel skit where he sung at the schools, haha. Those were so awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 28 Aug 2008, 10:47
@Ozy:

First I was amazed and stupefied.

And then 0:50 happened. I think my life is complete.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 28 Aug 2008, 13:39
Reminds me of this (http://www.youtube.com/watch?v=W91sqAs-_-g)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 28 Aug 2008, 15:43
Meh, I thought it would have been a lot better without the guy in the swimsuit. Didn't really add anything.

Though, the rest is pretty great.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 28 Aug 2008, 15:48
A guy in a bikini isn't comedic gold by itself, but the way the three other people kept straight faces throughout the ordeal was admirable.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 28 Aug 2008, 15:55
Moreso than the classical music angle, the perfect English diction is what made it funny for me.

Actually, a favorite pastime of mine is taking rap songs and speaking them in perfectly enunciated grammatical English.

"My name is Soldier Boy. I am fully inside that woman of ill-repute."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 28 Aug 2008, 16:09
The number of tribulations I have experienced amounts to ninety-nine; however, none of them involve a woman.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 28 Aug 2008, 16:09
The law enforcement officers/They see me driving in my large automobile/They are jealous of my many successes/Attempting to catch me trafficking contraband...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 28 Aug 2008, 16:26
(http://img144.imageshack.us/img144/8131/gocapgowd5.jpg)

(http://img206.imageshack.us/img206/1378/italianspidermanfd3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 28 Aug 2008, 17:14
Dude, seriously?

http://www.youtube.com/watch?v=JvNLlwkwP64 (http://www.youtube.com/watch?v=JvNLlwkwP64)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 28 Aug 2008, 17:30
From clicking on related videos I found my way to this gem:
http://www.youtube.com/watch?v=S86n_FYR4Kk&feature=related
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 28 Aug 2008, 17:33
yours truly as italian spodermon


(http://img.photobucket.com/albums/v12/sademie/italianspoodermon.jpg)


what happens when you put some blue food coloring on the chicken your room mate is trying to make in his crock pot. he threw it out.

(http://img.photobucket.com/albums/v12/sademie/bluechicken.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 28 Aug 2008, 17:37
Dude, seriously?

http://www.youtube.com/watch?v=JvNLlwkwP64 (http://www.youtube.com/watch?v=JvNLlwkwP64)

hahaha, oh wow.

That was literally the best thing I have ever seen.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: negative creep on 28 Aug 2008, 17:39
That Spiderman and Batgirl video is excellent.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 28 Aug 2008, 19:36
Italian Spiderman is awesome. I love when he just straight-up ice cold clocks that one chick after stealing her necklace.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 28 Aug 2008, 20:03
(http://cdn-www.cracked.com/articleimages/dan/husbands/reed4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 28 Aug 2008, 20:09
(http://i34.tinypic.com/vpvo6a.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 28 Aug 2008, 20:25
Wasteroo and I went to the same article (http://www.cracked.com/article_16512_6-worst-comic-book-super-husbands.html) to get our domestic disturbance pictures.  How modern!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 28 Aug 2008, 20:33
I had a nagging suspicion you got your picture from that article. Coincidences are cool!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 28 Aug 2008, 21:53
It makes my taco pop! (http://www.youtube.com/watch?v=_jxq6ZS3ms8)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 28 Aug 2008, 21:57
I try not to throw around the word 'gay' if I can help it, but the two lads featured in that video were pretty damn flamboyant.

If I didn't trust the internet as much as I do, I'd almost think that wasn't an actual commercial.

In case you didn't get the double entendre, straight from a youtuber's mouth:
Quote
IT MAKES MY TACO POP
LOL
HYMEN REMOVAL
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 28 Aug 2008, 21:57
(http://i36.tinypic.com/nl6gec.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 28 Aug 2008, 23:43
(http://www.pretentiousgamer.com/photos/hakbkaabe.jpg)

Oregon is not prepared for this man.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 29 Aug 2008, 00:06
It makes my taco pop! (http://www.youtube.com/watch?v=_jxq6ZS3ms8)

Her taco is the best! AMAZING!!

Also, re: eccentric oregon trail man

I think that if I lived back in those times, that's the kind of person I would be. I would either die very swiftly, or become superbly rich by accident.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: dennis on 29 Aug 2008, 02:04
Germans make the most bizarre music videos. (http://www.youtube.com/watch?v=MFPs20SSnkI&feature=related)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 29 Aug 2008, 06:14
Man. I can't find a picture of Spider-Man backhanding Mary Jane after finding out he was a clone.

Marvel heroes sure are douche bags.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jimmy the Squid on 29 Aug 2008, 06:18
No they're not, they're demonstrating moral grey areas!!!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 29 Aug 2008, 07:44
Man. I can't find a picture of Spider-Man backhanding Mary Jane after finding out he was a clone.

Marvel heroes sure are douche bags.

Batman! He spends all day working as a multi-millionaire industrialist running Wayne Industries, helping prop up the very top-heavy capitalist system that promulgates the gap between the rich and the poor and creates the conditions that push the bottom end of society towards lives of crime - and then he goes and spends shitloads of money of building fancy gadgets and cars and shit so he can go out at night and kick the crap out of the criminal element his daily lifestyle has helped create and allowed to flourish.

I reckon Gotham'd be a much nicer place if he just gave some money to charity rather than spending it on silly black outfits, expensive gadgets and decidedly environmentally-unfriendly big cars.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leinad on 29 Aug 2008, 08:57
Wow, way to make Batman sound lame. I hate you. That is the only super-hero I have ever liked. Please go sleep with your avatar, or something, I dunno.

PS: I don't really hate you.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 29 Aug 2008, 08:57
(http://i36.tinypic.com/2ef74ag.jpg)

And while we're on the subject, this has to be the least necessary demotivational I've ever seen. They're not funny when they just restate whatever is in the picture.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 29 Aug 2008, 09:23
 They do that a lot. People cannot accept the fact that they did not find the hilarious picture, so they have to add something not-hilarious to completely kill the joke.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 29 Aug 2008, 09:43
DEEAAAAAAAD!!!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 29 Aug 2008, 09:49
Edit: I'm an idiot.

(http://cdn-i.dmdentertainment.com/cracked/wong/duckfetus2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 29 Aug 2008, 09:54
Terrifying (http://www.youtube.com/watch?v=NznqXmfrdBk)

The original video is OLD'D, but I've not seen this version before, and I much prefer it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 29 Aug 2008, 10:25
Conversely, this (http://www.youtube.com/watch?v=s4SbRO97dhk&feature=related) makes me inexplicably happy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 29 Aug 2008, 11:10
Lazytown is the only case where techno should be allowed in children's programming.

Edit: Holy hell the slow version makes me feel like I am on drugs.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 29 Aug 2008, 11:43
jesus christ, i almost shit myself at about 1:35
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thaes on 29 Aug 2008, 11:49
The slow version is the most hilarious thing Ive seen... well, today, actually.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 29 Aug 2008, 11:50
Vous tes un pirate! (http://www.youtube.com/watch?v=Gv1RcXVoqr4&feature=related)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 29 Aug 2008, 14:46
You're just saying that because I quoted you in my signature.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 29 Aug 2008, 15:33
No, I'm saying it because your post quality soars high above the newbie average*! To be fair though, very recently there has been an influx of really good new folks, so you're not alone in this.

*personal opinion, the rest of the forum might hate your guts for all I know

what happened to midnight umbreon?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Beast on 29 Aug 2008, 15:54
just wondering... i hope he didn't get scared off
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 29 Aug 2008, 18:36
(http://img98.imageshack.us/img98/6849/rachllr0.jpg)

(http://img294.imageshack.us/img294/8657/batmanhasnolimitspi8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cernunnos on 29 Aug 2008, 20:47
http://www.youtube.com/watch?v=j_UYeYjlMWs

It would probably not be a good idea to watch this on drugs.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 29 Aug 2008, 20:57
I watched that without any sound, since my computer speakers are broken.

It was terrifying.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 29 Aug 2008, 23:10
God damnit if that pirate song isn't catchy. And actually I'm pretty sure they were saying tu, not vous, my guess is children's shows aren't particularly formal.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 29 Aug 2008, 23:44
 I couldn't quite make it out, but to me it sounds more soft 'v' than 't'.

But you're probably right. Lazytown, though being the classiest show on TV for kids nowadays, probably isn't too formal.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: thegreatbuddha on 30 Aug 2008, 00:40
Moreso than the classical music angle, the perfect English diction is what made it funny for me.

Actually, a favorite pastime of mine is taking rap songs and speaking them in perfectly enunciated grammatical English.

"My name is Soldier Boy. I am fully inside that woman of ill-repute."


Wait, what? (http://stuffwhitepeoplelike.com/2008/08/18/107-self-aware-hip-hop-references/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 30 Aug 2008, 01:09
 Shorty has stated on numerous occasions that the african american fellow that she is currently dating is not up to par with what she expects out of a significant other, and he does not even amount to feces!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 30 Aug 2008, 15:18
Actually, I think we were doing the exact opposite of what is detailed in that article..
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 31 Aug 2008, 04:40
(http://i278.photobucket.com/albums/kk92/_beatingheartsbaby/frappycandidates.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 31 Aug 2008, 09:30
(http://www.hyperdeathbabies.com/anomaly/images/063-mona-lisa.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Patatat on 31 Aug 2008, 10:56
The backwards man and his terrible laugh will haunt me forever.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 31 Aug 2008, 11:02
(http://blog.tambayanbox.org/wp-content/uploads/2008/08/michael-phelps-is-evil.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 31 Aug 2008, 15:27
I love that Phelps pic, it would have been really funny if true. If a little wrong.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 31 Aug 2008, 18:09
Patatat, you're a goddamn dirty avatar-copier.

(Although, admittedly it is not me who is pictured.)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 31 Aug 2008, 18:42
Found this in my Photobucket recently. I have this old book at home called Safe Counsel which is about eugenics and safe sex and stuff like that. The thing is that it's from the 1920s and is hilariously outdated. I posted some images from it on 4chan a while back and here's what I got in return.

(http://i87.photobucket.com/albums/k157/jcsunshine/safe%20counsel/turks.jpg)

(http://i87.photobucket.com/albums/k157/jcsunshine/safe%20counsel/thebitch.jpg)

(http://i87.photobucket.com/albums/k157/jcsunshine/safe%20counsel/foracrap.jpg)

(http://i87.photobucket.com/albums/k157/jcsunshine/safe%20counsel/cantsee.jpg)

(http://i87.photobucket.com/albums/k157/jcsunshine/safe%20counsel/blowjob.jpg)

(http://i87.photobucket.com/albums/k157/jcsunshine/safe%20counsel/bisexuals.jpg)

(http://i87.photobucket.com/albums/k157/jcsunshine/safe%20counsel/arsenic.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 31 Aug 2008, 18:52
Does the fourth one down refer to how masturbation causes blindness?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 31 Aug 2008, 19:05
 I would like to see the originals.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 31 Aug 2008, 19:29
Monkey Olympics: Journey To the East (http://www.youtube.com/watch?v=QXeuyo8fGKQ)



Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 01 Sep 2008, 10:54
Science! (http://danieldl.info/post/42743097/man-electrocutes-pickle-to-demonstrate-power-of)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 01 Sep 2008, 11:02
The most interesting bit of that is he totally misses a potential metaphor at the end with his whole "Do not try this at home bit".
Religion is dangerous, folks, leave it to the professionals!

Also: If I remember correctly from an episode of QI where they showed a video of someone else doing it, he's got his science hideously wrong.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 01 Sep 2008, 11:09
Is anyone else wondering if that pickle is kosher?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 01 Sep 2008, 12:28
I would have thought that electrocuting pickles is more of a job for the Flying Spaghetti Monster. If we're talking Christians then don't you have to ram a lightning bolt through a loaf and a couple of small fish?

Or is that too greek-pantheon?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 01 Sep 2008, 13:20
(http://web.ncf.ca/ek867/fish.harpers.tshirt.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 01 Sep 2008, 13:35
I didn't even watch the video. Just reading the description about how he "Electrocutes a pickle to prove Christianity is the one true religion" was enough to make me howl with laughter.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 01 Sep 2008, 14:54
(http://i4.photobucket.com/albums/y147/ThePQ4/wat.jpg)

Is it bad that that was like the most hilarious thing I've seen all day?

Also:
(http://i4.photobucket.com/albums/y147/ThePQ4/137352_just_cant_blend_in_1_vw.jpg)
(http://i4.photobucket.com/albums/y147/ThePQ4/NoGorilla.jpg)
(http://i4.photobucket.com/albums/y147/ThePQ4/cosplay.jpg)
(http://i4.photobucket.com/albums/y147/ThePQ4/hardgay.jpg)

...I obviously found the Demotivational gallery on Spiked Humor...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wasteroo on 01 Sep 2008, 15:00
It was uncomfortably funny even without the last two lines. Then I laughed for a good minute or so.

wat
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 01 Sep 2008, 16:09
All those other images are dumb, but that WAT transcript is hilarious.

re the pickle guy: I was kinda hoping he'd fuck up and electrocute himself. OH MAH GAWD THE POWER OF CHRIST OVERWHELMS ME
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 01 Sep 2008, 22:16
(http://media.tumblr.com/IvoIf5iHrbv3dql384nqu4OD_400.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 01 Sep 2008, 22:26
Somebody has readed my diary.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 01 Sep 2008, 22:29
(http://img135.imageshack.us/img135/3869/noplayingbk6.jpg)

(http://img135.imageshack.us/img135/9792/pitythefoolcp8.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 02 Sep 2008, 08:30
(http://www.hyperdeathbabies.com/anomaly/images/073-bubble-gum.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 02 Sep 2008, 09:00
(http://www.vgcats.com/super/images/080619.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: I is Grammar on 02 Sep 2008, 09:14
Lemme get this straight, regarding the pickle guy.  To be an enlightened Christian, you have to be stabbed by a fork in both ends and then electrocuted?  Geez, what people do for enlightenment.   
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 02 Sep 2008, 11:21
Actually to be an enlightened Christian you need to be a pickle, stabbed in both ends with a fork, attached to a simple jury-rigged sling device with a rather dangerous looking mains electrical hook-up attached. And from this all you get is a kinda red glow.

For me, my choice of Atheism is more "Go to the shop, get a light bulb, plug it in and switch it on." More light, better efficency and less effort, safer.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 02 Sep 2008, 11:49
Oh nuts. And here I thought being a Christian would help me find peace in this world and the next. Turns out, it just makes me in to glowing pickle. Back to the UFO Cult for me.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leinad on 02 Sep 2008, 11:51
Isn't that what peace is? Being a glowing pickle? Damn, I would love to be a glowing pickle. Life would be so much simpler.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: negative creep on 02 Sep 2008, 15:10
But you would have to wear a fork up your ass!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leinad on 02 Sep 2008, 15:20
That would suck, it's true.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 02 Sep 2008, 16:52
I give you... LOLanimals?

(http://icanhascheezburger.files.wordpress.com/2008/08/funny-pictures-firefox-tries-to-retrieve-your-file.jpg)

(http://icanhascheezburger.files.wordpress.com/2008/08/funny-pictures-panda-will-let-you-take-the-bamboo.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 02 Sep 2008, 17:04
(http://img440.imageshack.us/img440/3730/myfirstcavitysearchao8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 02 Sep 2008, 22:14
I would like that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gridgm on 02 Sep 2008, 23:22
i have immediatly misinterpreted that as "i would like a cavity search" ... it's quite disturbing
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Napoleon the Clown on 03 Sep 2008, 01:30
I would have thought that electrocuting pickles is more of a job for the Flying Spaghetti Monster. If we're talking Christians then don't you have to ram a lightning bolt through a loaf and a couple of small fish?

Or is that too greek-pantheon?
Eh, they all rip each other off, in the end.  The Ancient Egyptian priests were parting the Nile long before Moses was born.

Though I do feel bad for the rational Christians out there.  Having idiots like this jumping into the spotlight.  I'm glad the ones I deal with are good people instead of the sanctimonious holier-than-though assholes that are so damned vocal.

(http://i2.photobucket.com/albums/y43/NapoleontheClown/28ssndyixtuephzmfya.jpg)

Mandatory:
(http://i2.photobucket.com/albums/y43/NapoleontheClown/hiss.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 03 Sep 2008, 04:13
Man what, why are we going back to shitty fake demotivator things again. 

Here is a picture.

(http://img.photobucket.com/albums/v371/est_xplosif/random/SERIOUSBUSINESS.jpg)

It shows you how serious computer business is.

Serioussssssssss
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 03 Sep 2008, 05:39
STOP DOING IT WRONG

HERE, THIS IS HOW YOU DO IT RIGHT
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 03 Sep 2008, 07:10
(http://img.photobucket.com/albums/v663/Lapuz/madagascar.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 03 Sep 2008, 07:15
Motivator is just a little played out. I blame RPG.net.

Back to random, I think BAZOOKA is a fun word to say.
(http://www1.istockphoto.com/file_thumbview_approve/424325/2/istockphoto_424325_plastic_bazooka_man_w_path.jpg)
I'm imagining everyone coming across this and saying Bazooka out loud wherever they are.
...
Heh.
Bazooka.

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 03 Sep 2008, 07:22
AHRG

FUCK YOU PRESIDENT OF MADAGASCAR.

I want to kill you.

It won't hurt.

You're not even real.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 03 Sep 2008, 07:22
Holy Shit, Eris just Won The Thread.   There is no way to beat that image. 

No.  Way.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 03 Sep 2008, 07:43
hang on man wat?

President Madagascar is President of Madagascar? I thought that was his name and he's the President of the Internet.

I gotta stop mainlining cough syrup at work...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 03 Sep 2008, 07:54
Here's an extended version:
(http://cassland.org/images/madagascar.gif)


Also:
(http://cassland.org/images/VS install.jpg)


And especially for us brits:
(http://cassland.org/images/charlescamilla.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 03 Sep 2008, 08:31
I just laughed my ass off at that extended President Madagascar thing.

And that horse is adorable...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 03 Sep 2008, 08:41
Bahahahah. Paul, you are swiftly becoming one of my favourites.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 03 Sep 2008, 09:53
Oh Yeah! They're going to activate the LHC next week, but here is what worries me:

(http://kuvaton.com/bshit/1220360595652.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 03 Sep 2008, 11:10
headcrabs!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 03 Sep 2008, 11:53
>snip out ruined joke<

Goddammit!

I hate those stupid things.

not trying to steal bandwidth, just wanted to post a pic I found on Google....
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: negative creep on 03 Sep 2008, 11:58
Oh Yeah! They're going to activate the LHC next week

That reminds me of the Large Hadron Rap (http://www.youtube.com/watch?v=j50ZssEojtM).

Has it been posted before? I don't know!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: celticgeek on 03 Sep 2008, 12:02
Yes, it has.  It's still worth it, though.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 03 Sep 2008, 13:04
(http://photos-f.ak.facebook.com/photos-ak-sf2p/v339/178/31/508122347/n508122347_748453_8476.jpg)

Best Crowd Surfer ever!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 03 Sep 2008, 13:17
Dude I wonder if that was voluntary, or if they just picked him up and started moving him forward. He's all screaming "Jesus put me the hell down my wife and kids are back there! What the hell assholes!"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 03 Sep 2008, 13:42
Dude I wonder if that was voluntary, or if they just picked him up and started moving him forward. He's all screaming "Jesus put me the hell down my wife and kids are back there! What the hell assholes!"

"Don't you realize this is how I ended up in a wheelchair in the first place?! What the hell guys?!"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 03 Sep 2008, 13:57
Nah, that dude probably plays MURDERBALL (http://www.youtube.com/watch?v=_kaT5dDiISw).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 03 Sep 2008, 14:02
The start and end of Jesus's life in the modern age:

(http://cassland.org/images/jesus_aol.jpg)   (http://cassland.org/images/jesus_ikea.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: carrotosaurus on 03 Sep 2008, 14:52
(http://img.photobucket.com/albums/v299/partyongarth/BeagleandFawn.jpg)

(http://img.photobucket.com/albums/v299/partyongarth/_flying_car.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 04 Sep 2008, 02:29
User Friendly has a nice one on the LHC today:
http://ars.userfriendly.org/cartoons/?id=20080904 (http://ars.userfriendly.org/cartoons/?id=20080904)
(It's part of an arc, if you feel it needs clarification)

Man, Krucifix does not sound Ikea at all. It would probably be called Ingo or Karl or Fredrik.
Heh! - so it should have been INRI...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 04 Sep 2008, 03:33
The phenomenon that is Ian:

http://www.youtube.com/watch?v=wSFJT1gdRf8 (http://www.youtube.com/watch?v=wSFJT1gdRf8)


And an interview with him:

http://www.youtube.com/watch?v=KP0BuiKb1pc (http://www.youtube.com/watch?v=KP0BuiKb1pc)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: gardenhead_ on 04 Sep 2008, 03:50
Paul, you are just on a streak of hilarity.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 04 Sep 2008, 04:38
http://www.eppendorf.com/int/hawkpopup.php?contentid=13

Automated pipettor+ The smoothest of boy band music=teh sexy

People, are we all listening to Roy Zimmerman (http://uk.youtube.com/user/RoyZimmerman)? He's a fellow with an acoustic guitar and a whole lot of incisive political wit. He fuckin rules (http://www.youtube.com/watch?v=vYyt4nyaq64).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: celticgeek on 04 Sep 2008, 08:11
Of course we are listening to Roy Zimmerman. 

I have a bunch of his stuff, and he was actually in the Tempe, Arizona area for a show last spring.  He was great, absolutely hilarious.

Highly recommended.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 05 Sep 2008, 11:56
(http://www.superdickery.com/images/stories/seduction/batman-leather-thong.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 05 Sep 2008, 13:16
DEMOTIVATOR ALERT






(http://img.photobucket.com/albums/v367/Shirebourn52/donotwant.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 05 Sep 2008, 15:26
(http://img.photobucket.com/albums/v620/theweaselking/Thirdmain/20080904ROAWR2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leinad on 05 Sep 2008, 15:32
Jesus shit that is cool! I want one of those....

Pointless Pic:

(http://i114.photobucket.com/albums/n280/Danny_California/magtheridon_down_081008b2822Pop.jpg)
Guys we just killed a fucking giant that killed a dragon. We own.


^Above is actually what my guild leader said on downing mag for the first time.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 05 Sep 2008, 15:51
(http://img374.imageshack.us/img374/1558/whathelooksliketn9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 05 Sep 2008, 16:55
Who is that and why does he look like Dream?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 05 Sep 2008, 17:54
Guys we just killed a fucking giant that killed a dragon. We own.

^Above is actually what my guild leader said on downing mag for the first time.
Man. Own. With an "o" and everything.

I am honestly envious. I know this sounds sarcastic, but I am being dead serious. I'm getting sick of the word pwn.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: on 05 Sep 2008, 23:23
 :mrgreen:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leinad on 05 Sep 2008, 23:36
Well the funny part is Magtheridon is a daemony kinda thing and GRUUL is the giant... which was why it was funny. But yeah, I hate pwn. I always say own, these days.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: on 05 Sep 2008, 23:57
I always say own, these days.



that that, internet culture
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 06 Sep 2008, 19:08
Who is that and why does he look like Dream?

It's the Golden Age character known as the Sandman

edit: or it's someone else, I don't really remember.  I think there was an arc in Sandman where they talked about it, something with demons taking the original and making him Dream.

edit:  my bad, Bronze Age Sandman
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 06 Sep 2008, 19:14
Who is that and why does he look like Dream?

It's the Golden Age character known as the Sandman


ha ha oh wow
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 06 Sep 2008, 20:35
(http://img.photobucket.com/albums/v619/ackblom12/Sandman.jpg)

One of the best superheros ever.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ledhendrix on 07 Sep 2008, 08:53
(http://www.nashspace.net/freshhell/condompolice2.jpg)

From this (http://www.wfhit.co.uk/) site. There are some hilarious comic strips there.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 07 Sep 2008, 20:27
I BE STROKIN'! (http://fr.youtube.com/watch?v=tGVnH39UzI8)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 07 Sep 2008, 21:32
WOP WOP WOP WOP WUP
WOP WOP WOP WOP WUP
WOPWOPWOPWOPWOPWOPWAWAWAWAWAWA (http://uk.youtube.com/watch?v=YQXiew-DQH4)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 07 Sep 2008, 21:47
(http://img92.imageshack.us/img92/2024/thehorrorzl0.jpg)

Walking Dead Fruit Pies (http://img185.imageshack.us/img185/2520/fruitpieshp5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 07 Sep 2008, 22:27
That picture

Nuke it god damn it!!

Why aren't you fucking blowing this shit up yet!!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gridgm on 08 Sep 2008, 03:56
WOP WOP WOP WOP WUP
WOP WOP WOP WOP WUP
WOPWOPWOPWOPWOPWOPWAWAWAWAWAWA (http://uk.youtube.com/watch?v=YQXiew-DQH4)

damnit i was expecting the goon show and all i got was dance music
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 08 Sep 2008, 04:10
Remember. (http://uk.youtube.com/watch?v=U53XWlGK4hY&feature=related)
to dance  (http://uk.youtube.com/watch?v=pSSJfrOmR1A&feature=related)
and listen right music (http://uk.youtube.com/watch?v=pk30a0qsVIk)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 09 Sep 2008, 07:57
(http://www.pretentiousgamer.com/photos/What_is_a_Sandwich_Chef.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 09 Sep 2008, 16:50
(http://img.photobucket.com/albums/v12/sademie/holyshitwhatthefuckisthat.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 09 Sep 2008, 17:09
(http://img297.imageshack.us/img297/7114/everydamntimenx8.png)
(http://img297.imageshack.us/img297/7459/everydamntime2rq9.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 09 Sep 2008, 18:04
(http://img.photobucket.com/albums/v12/sademie/1221008255581.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 09 Sep 2008, 19:37
yeah, lick my ass, bitch! (http://www.starterupsteve.com/swf/strife.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 09 Sep 2008, 20:45
why are you doing this
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 09 Sep 2008, 22:56
(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/maikl.gif) <---- Fuck yeah!!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 10 Sep 2008, 01:08
(http://www.photobasement.com/wp-content/uploads/2008/09/justjump.jpg) (http://www.photobasement.com/mixed-messages/)


Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 10 Sep 2008, 03:57
therapist

therapist

therapist


That is all.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 10 Sep 2008, 05:07
Is that why my ass has been hurting? He told me it was a physical manifestation of childhood trauma involving clowns!

THAT SON OF A BITCH!
 :x :x :x
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 10 Sep 2008, 09:47
waffle house wedding (http://www.gwinnettdailypost.com/ftp/multimedia/waffleweddingx/publish_to_web/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 10 Sep 2008, 10:03
(Michael Knight and KITT) <---- Fuck yeah!!

I love how calmly that guy comes out of the other room after a car comes CRASHING through a window, taking out half his apartment.

"Hmm... I thought I heard somethi-- UGH!"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 10 Sep 2008, 11:19
Dollface, are you an agent of Scientology?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 10 Sep 2008, 11:28
Mark, you do know that most of the forum members are scientologists?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 10 Sep 2008, 12:51
Why do you think I'm here? I prefer a target-rich environment. But I do like to be sure there are no innocents in the line of fire.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 10 Sep 2008, 13:50
MarkTBSc
Balloon animal serial killer
(http://forums.questionablecontent.net/Themes/qc/images/star.gif)
(http://forums.questionablecontent.net/Themes/qc/images/useroff.gif)Offline

Posts: 79




Posts: 79





Posts: 79




 :-D
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 10 Sep 2008, 13:56
...anyway...
I'm not sure if this has ever been posted before, but it made me laugh, so I don't care: X-Men: Death Becomes Them (http://www.starterupsteve.com/flash/html/xmen.shtml)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 10 Sep 2008, 17:35
Mark I find your comments EXTREMELY offensive. I will see that you are banned for good, I will.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CardinalFang on 10 Sep 2008, 17:36
(http://img.photobucket.com/albums/v620/theweaselking/Thirdmain/002cf9b3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 10 Sep 2008, 19:57
(http://img254.imageshack.us/img254/5001/79479885l8daqi1ek4ob3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 10 Sep 2008, 20:17
...That is possibly the greatest thing I have ever seen...
OMFG... I just got a great idea for an AD speech for Forensics. Omg, omg, omg.
THANK YOU!
(Trust me, this isn't as random as you think is)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 11 Sep 2008, 00:22
Good heavens Cartilage Head... You've terrified me into a re-examination of my life and a reversal of my deepy-held beliefs.

I adore you.

I simply must sing.

Oh, and Trollstormur... I'm sorry, I don't get it? You find my post-count amusing? Upsetting? You have a peculiar near-sexual fondness for the number 79? I won't even ask what the T-rex is for.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 11 Sep 2008, 03:58
Joker has no interest on batman (http://images.encyclopediadramatica.com/images/a/a3/Jokergay.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 11 Sep 2008, 06:33
C'mon people are you trying to kill this fun thread?

(http://holamun2.com/files/images/mun2-images/freejoles/stop-the-drama.gif)

Get in the game! Why so serious!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 11 Sep 2008, 07:53
http://www.youtube.com/watch?v=Qhk5uYXXuvs
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 11 Sep 2008, 10:29
I can't watch that clip without Inigo's "You keep using that word. I do not think it means what you think it means." quote drowning out half of what that guy says.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 11 Sep 2008, 11:37
A few years back, there was a Pirates of the Caribbean porno.  Now, there's a sequel (http://www.piratesxxx.com).

This is probably one of the funniest things I've seen in a long time.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 11 Sep 2008, 12:08
hey man that porno was pretty good
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 11 Sep 2008, 12:39
I know, but that trailer was hilarious. 

"What's wrong?"
"I just fucked my retarded cousin!"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 11 Sep 2008, 12:43
Ha ha oh man awesome page break.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 11 Sep 2008, 12:44
Man Mark why are you trying to kill the board
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Yakob on 11 Sep 2008, 13:46
Guys, I don't remember Sesame Street being this (http://www.youtube.com/watch?v=fZ9WiuJPnNA) awesome (http://www.youtube.com/watch?v=_7jpz_55EdM).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Noct on 11 Sep 2008, 14:00
I think I would actually like Jack Black more if he dedicated himself to childrens programming.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 11 Sep 2008, 20:32
(http://img374.imageshack.us/img374/154/hippoeatsdwarfgc9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 12 Sep 2008, 00:37
Simple ampersandwich, the board - like the Liver - is evil and must be punished...

Also, I'm kinda unsure if people are actually pissed at me or I'm just caught in the middle of some bizarre comedy skit...

(http://mydogshavefleas.com/fleasblog/wp-content/gallery/misc-pics/cookiebunny.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 12 Sep 2008, 02:55
I think I would actually like Jack Black more if he dedicated himself to childrens programming.

I do have to say, the very end of that clip, where both Jack and Elmo creepily say "octagooooon..." is kind of unnerving.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 12 Sep 2008, 12:14
(http://strips.bitstrips.com/fa3758b5863a1eeb52c32a553987bdc1.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 12 Sep 2008, 19:46
LOOK AT THIS PHOTOGRAPH (http://www.todaysbigthing.com/2008/08/29)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 12 Sep 2008, 22:00
This image reminds me of Ozy.

(http://blog.zygonia.net/content/binary/BestVennDiagramEver_10AF4/venn_thumb7.jpg)

(http://pitzipoanca.org/wp-content/uploads/2008/09/damn.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 13 Sep 2008, 23:51
I'm not sure which image you mean.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 14 Sep 2008, 04:08
LOOK AT THIS PHOTOGRAPH (http://www.todaysbigthing.com/2008/08/29)

I lol'd
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 14 Sep 2008, 06:01
(http://kuvaton.com/kuvei/o___o.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 14 Sep 2008, 07:43
I'm not sure which image you mean.

The first, m'dear.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Hunter on 15 Sep 2008, 16:33
(http://img225.imageshack.us/img225/2917/picture1dd4.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 15 Sep 2008, 20:02
Holy smokes.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 15 Sep 2008, 21:31
(http://img515.imageshack.us/img515/9231/needleslz7.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 15 Sep 2008, 23:08
(http://farm4.static.flickr.com/3022/2859493988_0b4757c77c_o.jpg)

HAY GUYS WHAT IS HAPENING IN THIS THREAD
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 15 Sep 2008, 23:20
Do we need another "rawr animals" thread 'cause either way, it's cool.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 15 Sep 2008, 23:23
(http://i28.photobucket.com/albums/c213/hey_there_fatty/MrCrab.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 16 Sep 2008, 04:28
(http://pics.fort90.com/forum/charizard.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ImRonBurgundy? on 16 Sep 2008, 17:10
(http://img.photobucket.com/albums/v32/TheHusseinSkank/454px-Family_guy_bingo.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 16 Sep 2008, 20:42
 What is missing from that is "Peter farts."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 16 Sep 2008, 21:20
(http://img152.imageshack.us/img152/399/lolcatfa5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Napoleon the Clown on 17 Sep 2008, 01:25
Is that the newest version of Beast from X-Men or something?  Or just Blue Kitty stroking his own ego?  Again. :P
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 17 Sep 2008, 03:05
Naw. It is indeed New Beast (http://upload.wikimedia.org/wikipedia/en/a/ad/Beastastonishing.jpg). Personally, I think someone spent too much time watching reruns of an old late '80s TV series. (http://en.wikipedia.org/wiki/Beauty_and_the_Beast_(TV_series))
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 17 Sep 2008, 19:55
Has anyone seen this comparison of Christian Bale and Kermit the Frog (http://community.livejournal.com/ohnotheydidnt/27350111.html) yet?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 17 Sep 2008, 19:58
Haha, yes. I laughed so much.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 17 Sep 2008, 22:10
(http://www.eegra.com/images/files/2008-07/gojira_no_tamago.jpg)

text reads "godzilla egg"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 18 Sep 2008, 00:38
Technically, it reads "Godzilla's Egg." It's possessive.

Just sayin'.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 18 Sep 2008, 04:06
(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/mario.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 18 Sep 2008, 08:15
Has anyone seen this comparison of Christian Bale and Kermit the Frog (http://community.livejournal.com/ohnotheydidnt/27350111.html) yet?

I call bullshit. One of those was quite clearly Robin the Frog (http://en.wikipedia.org/wiki/Robin_(Muppet)) as Tiny Tim, not Kermit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 18 Sep 2008, 08:21
Does anyone remember where that "The Adventures of Lord Mario" came from originally? I think I once followed a link in gabbly that was talking about game reviews that may have led me to that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 18 Sep 2008, 11:11
Yes. It comes from eegra.com.

(lower left corner)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 18 Sep 2008, 11:23
it's such an ugly and hacked on watermark that I figured that was some image host or blog that collects things like that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 18 Sep 2008, 11:34
Well, the art & comedy style looks similar...
(http://www.eegra.com/comics/2008/03/24.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: BlahBlah on 18 Sep 2008, 12:30
Some of the Eegra comics are quite good actually, unfortunately most of them are just horrible.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 18 Sep 2008, 13:26
YouTube - Ninja cat comes closer while not moving! (http://www.youtube.com/watch?v=muLIPWjks_M)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 18 Sep 2008, 14:56
If celebrities were from the Midwest (http://www.jeremyenke.com/category/fun-stuff/karl-jefferson/).

(They'd be fat)

Man, Nicole Kidman has scary eyes.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 18 Sep 2008, 15:43
YouTube - Ninja cat comes closer while not moving! (http://www.youtube.com/watch?v=muLIPWjks_M)

I can't stop laughing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 18 Sep 2008, 17:17
Ditto
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 18 Sep 2008, 18:04
If celebrities were from the Midwest (http://www.jeremyenke.com/category/fun-stuff/karl-jefferson/).

(They'd be fat)

Man, Nicole Kidman has scary eyes.

I never understood why people make such jokes. It's the deep South that's packed with fatties; everyone else but Colorado hovers in about the same ranges.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 18 Sep 2008, 18:14
Are you calling me fat, sir?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 18 Sep 2008, 19:17
(http://www.somethingpositive.net/arch/emokitty.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 18 Sep 2008, 21:52
what
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 18 Sep 2008, 21:54
:/
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 18 Sep 2008, 22:55
Yes.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 18 Sep 2008, 23:32
That's kind of messed up.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 18 Sep 2008, 23:43
urrrmmm.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 18 Sep 2008, 23:54
(http://i28.photobucket.com/albums/c213/hey_there_fatty/JOwhilelookingatatornado.gif)

Straight guys only no gay stuff.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 19 Sep 2008, 00:43
Wrist-slashing Cat-Girls and Guys with Tornado fetishes...

When did this thread get so twisted?

And no, that's not a pun.

I'm going to go watch more cheerful videos now... This for example: www.youtube.com/watch?v=wP9P3RQ-roM
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Storm Rider on 19 Sep 2008, 01:00
What the hell does JO stand for?

I guess I should be happy that I'm not familiar with it, now that I think about it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 19 Sep 2008, 01:20
JO = jerk off or some conjugational variation of such.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 19 Sep 2008, 01:22
gee, thanks robert
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 19 Sep 2008, 01:24
Yeah, thanks robert whoever you are.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 19 Sep 2008, 01:26
Thank you disney for this (http://www.youtube.com/watch?v=PeT45BELVzY&eurl=http://www.hilavitkutin.com/videoblogi/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 19 Sep 2008, 01:48
Considering some of the things I have seen in past "Pointless" threads, the "Something Positive" cartoon I posted is, well, middle-of-the-road. However, if it needs to be deleted, I'll be happy to do so. If so, someone please tell me where the rule book is for "some people can post shit but some people can't."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 19 Sep 2008, 02:37
I personally don't think it's over the top. It seems to fit right in.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 19 Sep 2008, 04:37
I just think it doesn't really belong here because there's nothing funny about it.  I always saw this as a humor thread rather than a purely random one.

With that in mind, a picture of me.

(http://yarga.net/anim/2008/joe.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 19 Sep 2008, 05:41
Sausage Hat!

(http://www.funhousetheatrical.com/images/Funny_hat.jpg)

Candy Ninja!

(http://farm3.static.flickr.com/2205/1808721505_3f3463d1f1.jpg?v=0)

(edit) found this gem just this very moment - thank you erik:
Put Your Ass Up In The Air (http://www.youtube.com/watch?v=32oU8YSFR8E)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 19 Sep 2008, 07:51
I just think it doesn't really belong here because there's nothing funny about it.  I always saw this as a humor thread rather than a purely random one.

Then you misunderstood the thread. The only rule of the pointless thread are the general rules of the community. Basically, anything Graham posts in this thread is about the only thing that shouldn't be posted in this thread.

That said, for further explanation of the image tragic_pizza posted, it was kind of a frustration outlet for the guy who did it (Randy Milholland, who does Something Positive). He has a huge vendetta against cat girls after going through con after con of creepy, obsessive, batshit cat girls (He seems to just hate cons in general judging by much of his output). It apparently became a long running gag between he and his girlfriend about psychotic emo kids who cut themselves for attention.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 19 Sep 2008, 08:39
I just think it doesn't really belong here because there's nothing funny about it.  I always saw this as a humor thread rather than a purely random one.

And as if the point weren't already obvious to most observers, humor is a relative thing. Me, I found that image hilarious.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: BankHoldUp on 19 Sep 2008, 10:31
Thought about putting this in the Video Games thread, but it looks more at home here:

Best. Guild App. Ever.

http://www.stickfigureninja.com/wow/application-audio.html (http://www.stickfigureninja.com/wow/application-audio.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 19 Sep 2008, 11:09
(http://i137.photobucket.com/albums/q235/chitlinpita/rs20080918.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 19 Sep 2008, 11:27
No way!  That's like one of those fake names you give when someone asks you...


Oh wait, I see.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 19 Sep 2008, 13:42
Yeah, personally, I rather like the "For you!" image. As Obsessions pointed out, it's funnier if you know the backstory. Randy only created the "For you!" image after someone snidely remarked that one of his earlier catgirl creations was really emo, a charge he found frankly ridiculous.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 19 Sep 2008, 14:47
I had a substitute teacher called Mike Hunt.

(http://icanhascheezburger.files.wordpress.com/2008/09/funny-pictures-dramatic-cat-asks-where-the-sting-of-death-is.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 19 Sep 2008, 19:52
OK guys I stand corrected.  I'll try to make it all better.

http://www.hulu.com/watch/35221/gorgeous-tiny-chicken-machine-show-global-housewarming
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 19 Sep 2008, 20:21
Personally I liked the Something Positive image, even if I didn't get it

(http://img89.imageshack.us/img89/2971/mudholegz6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 19 Sep 2008, 21:49
I had a substitute teacher called Mike Hunt.

Coincidentally, there is also a Mike Hunt who is a sports journalist for my local paper.  I feel sorry for him, considering that he has his name in the paper pretty much daily.  What's even better is he tries to cover it up by calling himself "Michael Hunt"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 20 Sep 2008, 05:38
I found that image hilarious.

Incidentally I also found people getting their panties in a bunch about the image hilarious.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 20 Sep 2008, 08:16
Man, I just didn't understand it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 20 Sep 2008, 12:44
Yes, well, that's why in-jokes are hilarious. Context!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 20 Sep 2008, 14:23
I Just don't find nor found it to be funny.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 20 Sep 2008, 17:33
OKAY DUDES
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 20 Sep 2008, 21:32
OKAY DUDES
I KNOW RITE :-D
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 21 Sep 2008, 13:35
(http://www.macksimpson.com/adverb/images/doritos-japan-lg-x1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 21 Sep 2008, 13:44
Meanwhile: Really LONG cat!
(http://kuvaton.com/kuvei/longcat2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 21 Sep 2008, 13:52
That is truely awesome.

And aren't you glad I didn't quote that image?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 21 Sep 2008, 14:36
(http://i35.tinypic.com/15yu3wz.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 21 Sep 2008, 16:33
(http://img259.imageshack.us/img259/9808/didntknowha0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 21 Sep 2008, 18:44
That image would be better without the text.

Matter of fact, that should go for most "funny" images.  I need a catchy acronym.  IBWT?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 21 Sep 2008, 18:57
Well that text wasn't completely extraneous, since not everyone would understand what that look meant. It's definitely nowhere near the pointlessness of pasting a giant FAIL over a picture.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 21 Sep 2008, 18:59
It's still funny as is, but I would prefer it if people didn't feel the need to spell everything out explicitly.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 21 Sep 2008, 19:02
Don't forget, ours is a society where people consider thinking to be elitist.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 21 Sep 2008, 23:25
What the hell? (http://uk.youtube.com/watch?v=vs1CA5hFdd4&feature=related)


Edit: why i suck so much
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Napoleon the Clown on 22 Sep 2008, 00:13
What the hell? (http://uk.youtube.com/watch?v=vs1CA5hFdd4&feature=related)

Link fixed for you... (Acceptable case of quoting previous post?)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 22 Sep 2008, 08:05
On the other hand, the girls in that are pretty cute. (I assume they are of legal age.)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 22 Sep 2008, 08:49
Here (http://www.spikedhumor.com/Article.aspx?id=163939) we have a man who got invited onto a talk show to fart.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 22 Sep 2008, 10:32
That literally had me in tears of laughter. I am ashamed, but I can't help but still find farts incredibly hilarious...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 22 Sep 2008, 11:15
Just really cool.
(http://kuvaton.com/kuvei/lightning.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Metope on 22 Sep 2008, 11:35
I've heard and seen a lot of weird fishing related stuff, but this has to be the weirdest.

(http://i41.photobucket.com/albums/e263/blooper663/elg2_960_1222099057-1-1.jpg)

(http://i41.photobucket.com/albums/e263/blooper663/elg3_503_1222099083-1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 22 Sep 2008, 11:51
(http://img515.imageshack.us/img515/9343/hmad6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 22 Sep 2008, 12:39
Most epic troll? (http://www.youtube.com/watch?v=E7mn4mo-QYE)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 22 Sep 2008, 13:07
Probably, but dang if that isn't scary regardless.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 22 Sep 2008, 14:47
Being a lurker over at /b/, I can tell you that yes, this is their idea of a joke.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 22 Sep 2008, 15:00
 Funny as hell.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 22 Sep 2008, 15:18
I kind of think it is!

Also - <img alt="Married To The Sea" src="http://www.marriedtothesea.com/090508/chinese-table-tennis.gif" width="650" height="523" border=0> (http://www.marriedtothesea.com/)
marriedtothesea.com (http://www.marriedtothesea.com)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 22 Sep 2008, 16:15
Anon got Oprah to say "over 9000 penises" on national TV. I don't think they can top that for a long time.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 22 Sep 2008, 19:58
I really hate 4chan but...this was good. I have to admit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 22 Sep 2008, 21:19
How I describe 4chan to people:

It's like $10 in quarters at the bottom of an out-house.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 23 Sep 2008, 00:55
4chan is the Internet's version of 'The wrong side of the tracks', but you've got to have it otherwise all those people would be living on our side of the tracks and they'd be saying stuff like that at PTA meetings.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 23 Sep 2008, 01:04
"Like SomethingAwful, but without the restraint or dignity."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 23 Sep 2008, 01:15
how i describe 4chan to people

"don't go there"

"just... just don't"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 23 Sep 2008, 02:01
Me talking to someone else at school: "Thank god someone else at this school has been to 4chan, now I don't feel slightly as dirty as I felt a moment ago."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 23 Sep 2008, 02:02
Man, that was awesome.  They got her to say the whole "doesn't forgive, doesn't forget" thing, then the 9000 penises thing had me giggling.  Good joerb.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 23 Sep 2008, 02:23
I gotta say, that does more harm to the Internet than anything else. Opramerica now thinks that there is a network of over nine thousand pedophiles on the Internet committing absurd amounts of rape constantly.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 23 Sep 2008, 03:02
I gotta say, that does more harm to the Internet than anything else. Opramerica now thinks that there is a network of over nine thousand pedophiles on the Internet committing absurd amounts of rape constantly.

Say that sentence outloud, it almost forces you to laugh. I got to absurd amounts of rape before I started laughing. Maybe I'm just tired.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 23 Sep 2008, 03:49
Where are your children?

Can you see them?

Maybe they're dead.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 23 Sep 2008, 03:55
I gotta say, that does more harm to the Internet than anything else. Opramerica now thinks that there is a network of over nine thousand pedophiles on the Internet committing absurd amounts of rape constantly.

As oppose to thousands of Opramericans living in constant fear of innocent Muslims as a result of blatant fear-mongering by the government and media? What /b/ have done here is essentially just a parody of that fear-mongering and it shows just how easily people will lap shit up if they have a friendly day-time television face to tell them.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 23 Sep 2008, 04:47
Wait, did we just conflate innocent muslims with child rapists? I think I've lost track of this thread now.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 23 Sep 2008, 04:59
I think you have as well.

Look here's a funny picture!1

(http://icanhascheezburger.files.wordpress.com/2008/09/funny-pictures-aquatic-mammal-does-exercise-and-feels-the-burn.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 23 Sep 2008, 05:02
tl;dr they did it for the lulz.

I'm glad lolrus is getting over his bukkit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gridgm on 23 Sep 2008, 06:13
Anon got Oprah to say "over 9000 penises" on national TV. I don't think they can top that for a long time.

it's scary when you know that the only reason that it says that many is who ever posted the orignal comment doesn't know that "two" filters to "OVER 9000"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Peet on 23 Sep 2008, 06:17
(http://superpoop.com/091808/the-gift-of-speech.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 23 Sep 2008, 06:22
By the time you realize they are not greeting you but actually trying to eat you, it is too late.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 23 Sep 2008, 07:39
 I audibly said "Holy fuck" and lol'd against my will at that bird picture. Nice work.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 23 Sep 2008, 12:25
(http://www.andrew.cmu.edu/user/jbistlin/headlines/256.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 23 Sep 2008, 12:34
Christ?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 23 Sep 2008, 12:35
Of Nazereth.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jesus Christ on 23 Sep 2008, 12:39
FUCKING WHAT I WAS IN THE SHOWER YOU DICKS
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Barmymoo on 23 Sep 2008, 12:40
has lost his manners since he died.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 23 Sep 2008, 12:41
Being nailed to a couple a' 2x4s and poked with a sharp stick will do that to you.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jesus Christ on 23 Sep 2008, 12:42
Fuckin' right it does. I am in a REAL BAD MOOD. You're all going to hell.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 23 Sep 2008, 12:43
FUCKING WHAT I WAS IN THE SHOWER YOU DICKS

This made me think of Jesus as Beetlejuice, where you say his name three times and he shows up and his head spins around and crazy crap starts happening. How much better would the Passion of the Christ have been if Michael Keaton had played Jesus?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 23 Sep 2008, 12:45
www.andrew.cmu.edu

classic
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 23 Sep 2008, 12:49
www.andrew.cmu.edu

classic

Man, I just spent so long trying to figure out what's funny about that site.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 23 Sep 2008, 15:00
I still don't see it :(
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 23 Sep 2008, 15:04
Dan.. that burrito picture, where did you find it? I had that in my folder for like a month and thought I got it from this thread, but I looked over the pages and I guess I didn't.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 23 Sep 2008, 15:13
Achewood IRC channel!

Quote
The topic for #achewood is: Official "5 - 4 = Unity" Fan Chat | http://www.andrew.cmu.edu/user/jbistlin/headlines/256.jpg | UFC #108: Echidna vs. Hamster
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: fozmo on 23 Sep 2008, 18:38
http://www.youtube.com/watch?v=ufMdo9AyMng

 :-(
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 23 Sep 2008, 20:05
(http://img140.imageshack.us/img140/1838/creepycalvinandhobbeshx0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 23 Sep 2008, 20:25
Anon got Oprah to say "over 9000 penises" on national TV. I don't think they can top that for a long time.

it's scary when you know that the only reason that it says that many is who ever posted the orignal comment doesn't know that "two" filters to "OVER 9000"

yeah but the comment was posted on Oprah's forums, not /b/. So the original text was over 9000, not Two.


edit: i lol'd at the previous picture until I realised that was suzie. now I feel dirty for some reason.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 23 Sep 2008, 22:24
Hobbes is so mad that Calvin is getting some action. No girls allowed.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 23 Sep 2008, 22:42
Why are there so many perverted and/or frightening strips of grown-up Calvin and Hobbes around? I mean, this one wasn't as bad as that one with the two Hobbes, but, eesh.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 24 Sep 2008, 03:58
(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/angryhog.jpg)

this thread is pointless

(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/catmarine.jpg)

this thread is pointless

(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/salamavaara.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 24 Sep 2008, 05:08
(http://www.getridofthings.com/images/pimples-2.jpg)
this point is threadless
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 24 Sep 2008, 12:42
(http://farm4.static.flickr.com/3218/2884567883_9b7e9a160f_o.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 24 Sep 2008, 13:18
Why are there so many perverted and/or frightening strips of grown-up Calvin and Hobbes around? I mean, this one wasn't as bad as that one with the two Hobbes, but, eesh.

I was just thinking the same thing.  C & H seem to inspire a disproportionate share of that kind of thing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: thehollow on 24 Sep 2008, 17:42
http://www.youtube.com/watch?v=AbAcbycyPW0

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 24 Sep 2008, 18:57
(http://img.photobucket.com/albums/v12/sademie/uterineprolapse.jpg)
CUNTPUNCH
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 24 Sep 2008, 20:42
YEAH MAN. YEAH.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 24 Sep 2008, 20:43
Ow. Fuck.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 24 Sep 2008, 21:23
(http://img255.imageshack.us/img255/9969/wantshisphonecallwx5.jpg)
(http://img255.imageshack.us/img255/7231/noky5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 25 Sep 2008, 00:14
616

In May 2005, it was reported that scholars at Oxford University using advanced imaging techniques had been able to read previously illegible portions of the earliest known record of the Book of Revelation, from the Oxyrhynchus site, Papyrus 115 or P115, dating to the mid to late third century. The fragment gives the Number of the Beast as 616 (chi, iota, sigma), rather than the majority text 666 (chi, xi, sigma). In Eastern Greek 616 is chi-iota-sigma or XIC. Eastern forms of Greek used the Lunate Sigma (which resembles an upper case C) as seen on many ancient Christian religious artifacts. The other early witness Codex Ephraemi Rescriptus (C) has it written in full: hexakosiai deka hex (lit. six hundred sixteen).

Significantly, P115 aligns with Codex Alexandrinus (A) and Codex Ephraemi Rescriptus (C) which are generally regarded as providing the best testimony to Revelation. Thus, P115 has superior testimony to that of P47 which aligns with Codex Sinaiticus and together form the second-best witness to the Book of Revelation. This has led some scholars to conclude that 616 is the original number of the beast.[13][14]
Red arrow points to χιϛ'(616), "number of the beast" in P115 deciphered in May 2005.
Red arrow points to χιϛ'(616), "number of the beast" in P115 deciphered in May 2005.

Dr. Paul Lewes in his book, A Key to Christian Origins (1932) wrote:

    "The figure 616 is given in one of the two best manuscripts, C (Codex Ephraemi Rescriptus, Paris), by the Latin version of Tyconius (DCXVI, ed. Souter in the Journal of Theology, SE, April 1913), and by an ancient Armenian version (ed. Conybaere, 1907). Irenaeus knew about it [the 616 reading], but did not adopt it (Haer. v.30,3), Jerome adopted it (De Monogramm., ed. Dom G Morin in the Rev. Benedictine, 1903). It is probably original. The number 666 has been substituted for 616 either by analogy with 888, the [Greek] number of Jesus (Deissmann), or because it is a triangular number, the sum of the first 36 numbers (1+2+3+4+5+6...+36 = 666)".

Professor David Parker, Professor of New Testament Textual Criticism and Paleography at the University of Birmingham, thinks that 616, although less memorable than 666, is the original. Dr. Ellen Aitken said, Scholars have argued for a long time over this, and it now seems that 616 was the original number of the beast. It's probably about 100 years before any other version."


But on other hand

(http://i163.photobucket.com/albums/t282/dttbuddha/cuntpunch.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 25 Sep 2008, 00:56
(http://www.blkmrktgallery.com/store/photos/735.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 25 Sep 2008, 01:12
That Doggy is thinkin' of England  :-D
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 25 Sep 2008, 02:31
That doggy makes CheezbrgrShooz look just DAMN relaxing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 25 Sep 2008, 19:09
http://www.philintheblanks.com/comics/manenough.html
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 25 Sep 2008, 19:44
FUCKIN' A.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 25 Sep 2008, 21:12
HOLY SHIT THAT WAS AWESOME
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 25 Sep 2008, 22:21
(http://img527.imageshack.us/img527/3889/godzillavk3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 26 Sep 2008, 11:04
(http://newsimg.bbc.co.uk/media/images/45049000/jpg/_45049658_rossy226b.jpg)

Dude flew a jetpack over the English Channel! (http://news.bbc.co.uk/1/hi/uk/7637327.stm)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 26 Sep 2008, 11:35
THE FUTURE

I SEES IT
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 26 Sep 2008, 12:52
And it's beautiful.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 27 Sep 2008, 08:33
a bit dissapointing though, he had to jump out of an airplane to get started, and parachuted down. That needs to be fine tuned.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eli on 27 Sep 2008, 09:24
Joke or real? You decide!

http://christiannymphos.wordpress.com/
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 27 Sep 2008, 11:06
I Will Survive (http://www.youtube.com/watch?v=Xui7x_KF7bY) for Fiddle, Piano, Falsetto and Eastern European.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 27 Sep 2008, 11:38
Those guys are amazing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Metope on 27 Sep 2008, 16:19
Plantman knows where the plants will grow. (http://www.youtube.com/watch?v=EQiSgWGAc24&eurl=http://freakangels.com/whitechapel/comments.php?DiscussionID=2478&page=1)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 27 Sep 2008, 17:11
I don't know if this has been posted before but....

(http://i525.photobucket.com/albums/cc336/spacethief/1194325983981.jpg)

WTF WTF WTF??
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Hunter on 27 Sep 2008, 19:38
(http://img220.imageshack.us/img220/703/picture1bz0.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 28 Sep 2008, 03:59
CLOOOOWWWWN MEEEAAAT

OH MAN. I used to have that shit in my sandwiches all the time as a kid.

Or I'd have it on it's own and poke the clown's eyes out.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 28 Sep 2008, 04:40
I don't know if this has been posted before but....
WTF WTF WTF??

I worked in a factory that made those this summer.

Chicken though, not pork.

It was gross. I'm not going back.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 28 Sep 2008, 10:29
Man, why would you want to eat that? It's all "OM NOM NOM YOUR FACE" creepy
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 28 Sep 2008, 12:39
Quote from: Eegah
progris riport 1 sep 2
the doktor sed they goin to giev me a operashun to fix me bristol sed her mom wood pay for it
i lik bristols mom
the doktor showd me a babby namd TRIG thei wer doing the operashun on first but hes just a babby so he cant talk
the doktor also sed it was importunt for me to be smart sun but he didnt say y
they sed i shoud be smart by heloween i cant wait for heloween i want to be a mous a clevr mous

progress report 7 sep 12
The operashun was ok. I was sleeping while he did my head. Misses Palin saw me when I waked up yesterday. I could tell Misses Palin had been crying but I dont know if it was cause of me or the bilding that fell down on tv yesterday.
They let me see Trig. He was laughin and drawing funny signs with a crayon. The Doctor said he was writing integrals, I dont no what that means but the Doctor said I'll find out by next week.

Progress Report 14 September 17
I cannot believe the family never told me that Trig was Mrs. Palin's child until yesterday. I can see now why he and I had been selected for the experiment.
The doctors and researchers have given me a large library of economic works by Milton Friedman, Friedrich Hayek, John Nash and Gunnar Myrdal. It appears they are responding to my rise in intelligence by focusing my studies in an economic direction. Ordinarily I may protest but seeing as they have blessed me with the fountain of knowledge I can refuse this any more than I can the wedding that Bristol and Mrs. Palin are planning. Bristol has gotten somewhat pudgy lately but no one mentions it and it is hardly my place to ask why.

Progress Report 20 September 23
President Bush telephoned me this morning while I was preparing my final disproof of Das Kapital and asked me to draft his economic bailout program. I suggested to him that he should draft a consortium of various economic authorities from universities across the United States but he fiercely rebutted, claiming that because I have not attended a university I should be free from the ivory tower's "liberal taint" which plagues campus grounds and therefore stand to be our country's only hope. Therefore I have spent the afternoon pouring over the details of Keynesian Economic theory and hope to have a logical package together by this evening which will protect the interests of Bush, McCain and Mrs. Palin. With luck this will pass both houses of Congress and be signed before it is discovered that it grants independence to the entire former Confederacy--this may be distasteful to the American public but my calculations show that jettisoning the South is the only possible course of saving the rest of the nation.
Trig has been fidgeting a good amount in recent days, and his constant crying has served as a distraction to Mrs. Palin and Bristol as they plan our wedding. I am becoming increasingly concerned at the obvious parallels between Trig's emotional trajectory and my own.

Progress Report 28 October 4
I fear that while I have been granted superhuman intelligence my lack of experience to sociaty means that I simply cannot connect with the American populace as a whole. Mrs. Palin did a superb job at Thursday's debate with Senator Biden, perfectly mimicing the instructions I was giving to her over her earpiece in response to the questions and Biden's remarks. Early polling however has shown a marked drop in Mrs. Palins, and consequently Mr. McCain's, approval because the policies I had determined to be most beneficial to America given the economic and social theories available to me in the University of Juneau library were percieved as cold-hearted and outright evil by Americans as a whole. This may be the case but I do not believe my numbers are in error.
Trig does nothing but sob now. He no longer scrabbles new mathematical theory, and his proof of the Riemann Hypothesis has been shown to be in error. Mrs. Palin has given permission for the baby to be hospitalized. My wedding has been postponed until after the election to "prevent distraction."

Progress Report 32 October 20
Trig died today in his doctor's arms. I am scared.

Progres report 40 Octobr 31
Misses Palin says I cant go out for halloween tonight even though she bought me a horse costume before I got smart. She's been very mean lately because the "electoral colleg" had all its south states removed after Bush signed the money deal I wrote a month ago. I wish I could remember why, I dont remember so good anymore

progrs report 44 novembr 8
Mises Palin has ben crying all day. She said she faild a test. i trid to say its okay and that i fail tests too and maybe if she studys hard next tim shell pass. i told her bristl past her prengunsee test so she must be smart so her mom must be too. then Misses Paln got somthin in her i and had to leev the rom. boy i sur puld a Levi Johnston this tim.

progris riport 47 novembr 12
i askd bristl abot are wedin and she sed talk to her dad
her dad sed hey levi lets go huntin then well talk about the wedin whil wer out
i sed ok but let me rite in my jurnal first
so wer gona go huntin and then il rit in my jurnal again too but first were goin to put flowrs on Trigs grave in the bak yard.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 28 Sep 2008, 13:50
Quote from: Eegah
progris riport 1 sep 2
...superblock...

I should be working. I don't know if I should laugh at that or if I should be sad. I'm oddly indifferent. Damn you people stopping me from my work!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 28 Sep 2008, 15:54
Johnny.

Where did you get that?

Amazing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 28 Sep 2008, 17:54
(http://www.asofterworld.com/clean/diaperprices.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 28 Sep 2008, 19:07
Quote
It just doesn't make sense. The meat you get out of a crocodile is just not worth the risk it takes a predator to acquire.

Psh. I bet all that cat thought was "ooh ooh, it's moving! Kill kill kill kill, hey it's biting me! *Fierceness* Why'd it stop playing? Ooh, food! Yay. Now for some sleep. Tomorrow gazelle."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 28 Sep 2008, 19:20
That attack was personal. That croc must have eaten the leopard's brother or something.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: octodexy on 28 Sep 2008, 19:41
The croc obviously never called after they had sex.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 28 Sep 2008, 19:53
Now, normally I worry when Adam Corolla starts making sense to me, but this does remind me of his theory that crocodiles are only ever defeated because they've been around so long they can't even really begin to fathom something other than another, larger crocodile messing with them to begin with. I can't imagine anything making it through the reptile brain other than "Wait, are you shitting me?! This is not happening. My people are legend."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 28 Sep 2008, 20:48
(http://mentalfruition.com/random/bloody_hell.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 28 Sep 2008, 22:38
(http://www.worthalaugh.com/wp-content/uploads/2008/07/mom.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 28 Sep 2008, 23:11
Can two people have orgy?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 28 Sep 2008, 23:51
Oh hey, look a demotivator!

(http://www.mydd.com/images/admin/mcain_debate.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 29 Sep 2008, 04:55
Can two people have orgy?
Well, they didn't say exclusively  your mom.
...although that does generate redundancy with "love" and "share".
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 29 Sep 2008, 11:12
I used to orgy with my mom all the time.


No, not that kind of orgy, you perv!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 29 Sep 2008, 11:23
There's another kind?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 29 Sep 2008, 11:44
(http://img219.imageshack.us/img219/9779/reasonablear7.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 29 Sep 2008, 12:00
(http://fc77.deviantart.com/fs7/f/2005/183/0/f/nightatfourside.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 29 Sep 2008, 12:59
Man, Ness is jammin out
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 29 Sep 2008, 13:09
That is only further justification for Jeff being the best part of that game.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 29 Sep 2008, 15:34
(http://www.bigfatwhale.com/archives/bfw_326_big.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 29 Sep 2008, 15:50
I wish Canadians rode moose.  :-(
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cam on 29 Sep 2008, 18:18
(http://www.bankholdup.com/Economy2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Yakob on 29 Sep 2008, 19:27
McDonald's- Now with Poutine!

This seems out of place. All of the other bits of the picture are kind of outlandish, but the poutine bit isn't. I'm pretty sure some McDonald's (and for sure other fast food places like Dairy Queen) up here do sell poutine. I'm sure a lot of you are aware of this, it just struck me as odd that it was included in the comic.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 29 Sep 2008, 19:30
See, people with signs telling us to go back to America hit me as the least unlikely bit, but hey, whatever.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 29 Sep 2008, 19:31
@ Yakob.
I think they're talking about American McDonald's. I don't think there are too many of those around.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Yakob on 29 Sep 2008, 19:36
Yeah, I know, what I'm trying to say is that that I can see something like that actually happening, but the other bits of the comic are varying degrees of farfetch-ed-ness.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 29 Sep 2008, 22:18
Man, poutine does not even sound like something that I would eat.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 29 Sep 2008, 23:02
(http://wayfinderexperience.com/forums/attachment.php?attachmentid=1245&stc=1&d=1222281454)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 29 Sep 2008, 23:29
Yeah, I know, what I'm trying to say is that that I can see something like that actually happening, but the other bits of the comic are varying degrees of farfetch-ed-ness.

Absolutely. Everybody knows Neil Peart writes the lyrics in Rush. Duh.

(incidentally if McDonalds here sold poutine I would go there sometimes. Nom nom poutine)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 30 Sep 2008, 11:35
I would go if they had yam fries, for they are the greatest gift to mankind.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 30 Sep 2008, 14:07
(http://cache.gawker.com/assets/images/consumerist/2008/09/sepmad.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 30 Sep 2008, 14:10
Ah yes, that is making the blog rounds.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 30 Sep 2008, 14:40
They spelled Barclays wrong
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 30 Sep 2008, 14:57
Ben Kingsley - Minor Threat (http://vimeo.com/1719921)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 30 Sep 2008, 16:20
(incidentally if McDonalds here sold poutine I would go there sometimes. Nom nom poutine)

Hell, it couldn't be any worse for you than the other stuff they sell. Though apparently I never got proper poutine in Canada, and I tried both a pub and a zoo! I mean, the zoo should have sold it, right?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 30 Sep 2008, 16:28
(http://cassland.org/images/Moles.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 30 Sep 2008, 16:34
thems good eatin'
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 30 Sep 2008, 18:53
Would that be red meat?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 30 Sep 2008, 20:36
(http://img248.imageshack.us/img248/8766/algorechiuahiarg2.jpg)

(http://img248.imageshack.us/img248/7161/annoyingub9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: celticgeek on 30 Sep 2008, 21:19
In as much as none of the presidential candidates are worth anything, I propose this: 

celticgeek for president!!! (http://www.tsgnet.com/pres.php?id=370743&altf=Dfmujd&altl=Hffl)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 01 Oct 2008, 02:54
(http://bopmyspace.com/funny/images/bpic2604.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 01 Oct 2008, 03:19
(http://punditkitchen.files.wordpress.com/2008/08/political-pictures-plane-crash-buy-own-gas.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 01 Oct 2008, 03:35
Scary, because I didn't look at the plane first...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 01 Oct 2008, 05:20
So a dude decks a shark to save his dog.
This is awesome. (http://www.belfasttelegraph.co.uk/news/world-news/man-punches-shark-to-save-pet-dog-13988971.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 01 Oct 2008, 06:17
(http://img440.imageshack.us/img440/1796/28949orig1181805099604lf1.gif) (http://imageshack.us)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 01 Oct 2008, 06:24
Linky no worky, gettin' a "don't steal our goshdarned bandwidh" image.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 01 Oct 2008, 06:28
Whoops
Fix'd
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: BlahBlah on 01 Oct 2008, 08:49
(http://punditkitchen.files.wordpress.com/2008/08/political-pictures-plane-crash-buy-own-gas.jpg)

That petrol isn't that expensive though? 1.79 is what, ~0.9 pence, that's pretty cheap.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 01 Oct 2008, 08:51
That's the point, it is about half the price it is today
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 01 Oct 2008, 08:59
Numerically, 1.59 is the only slightly above the petrol price here.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 01 Oct 2008, 09:14
Yeah, but considering the Donkey/Elephant hybrid image in the corner, it stands to reason that that's a US gas station. That's the average price of gas back in like 2005. Now it's up around $3.50.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 01 Oct 2008, 09:23
Well I noticed the plane first; the petrol price only becomes remarkable after recognising that it's an american petrol station and then wondering for a while what the conversion rate between (australian) cents per litre and whatever units you use is.

I guess it just loses it's effectiveness once you take it out of it's context.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 01 Oct 2008, 09:51
Silly, the US is the only country that matters.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 01 Oct 2008, 11:30
Oddly enough I noticed the symbol on the sign, thinking it was some sort of Pepsi thing, then noticed the plane, then after reading the image noticed the low gas prices.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 01 Oct 2008, 15:36
They spelled Barkley wrong

he chaos dunked the dow
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Storm Rider on 01 Oct 2008, 16:59
go back to lf
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 01 Oct 2008, 18:13
Why none of us posted this earlier is beyond me...

(http://tacogaywolf.com/gay-food-fetish5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: sean on 01 Oct 2008, 18:15
oh god

oooooooooooooooooooooooh god
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: bicostp on 01 Oct 2008, 20:14
Well I noticed the plane first; the petrol price only becomes remarkable after recognising that it's an american petrol station and then wondering for a while what the conversion rate between (australian) cents per litre and whatever units you use is.

Those prices are in US dollars per US gallon of gas*. They're hovering around $3.50 a gallon now. :wink:

Here in the United States we don't care about your funny money and silly metric system. ;P
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 01 Oct 2008, 20:37
HOLY GOD, AUUUUGH

Why the hell would you do that
In 100% honesty, I got that nauseous feeling you get before barfing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 01 Oct 2008, 20:40
Who the hell would ever find that sexy in any way?

Misconception, you are a terrible person.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 01 Oct 2008, 20:41
TacoGayWolf

Guys, this is hawt. I don't know why you're getting all worked up over this. It's a work of genius.

Taco. Gay. Wolf.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 01 Oct 2008, 20:42
Thank you Hannah! I am glad someone sees it as I do.

And guys, just remember what is important- the taco meat gets kinda hot as the room gets spicy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 01 Oct 2008, 20:45
It's nowhere near the worst thing I have seen online (or in the thread), so if you want I can find everyone some rule #34 stuff.

It may be hard to find things that won't get me banned, but I will definitely do it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 01 Oct 2008, 21:05
I think it's largely because, to me, it looks like he shit out that taco meat onto the plastic tray and is holding it out, both menacingly, and as if he's proud of it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 01 Oct 2008, 21:07
Cat clock will not let you sleep in (http://www.youtube.com/watch?v=as12-yZGg-k)

(http://img527.imageshack.us/img527/4817/sadmh6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 01 Oct 2008, 21:34
Taken by itself, that comic is actually horribly depressing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 01 Oct 2008, 21:41
(http://i95.photobucket.com/albums/l141/misterroundheels/Starr8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 01 Oct 2008, 21:48
Is that the most awesome action figure ever?


Actually no, it isn't. (http://www.flickr.com/photos/rbieber/234303813/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 01 Oct 2008, 21:51
I actually own one of those Jesus figures.

And one of these: http://www.accoutrements.com/products/11071.html (http://www.accoutrements.com/products/11071.html)

And these: http://www.accoutrements.com/products/11024.html (http://www.accoutrements.com/products/11024.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 01 Oct 2008, 21:51
Oddly enough the Jesus action figure has wheels on its feet
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 01 Oct 2008, 21:53
For real levitating action!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 02 Oct 2008, 02:10
Oddly enough, I have the Sigmund Freud action figure.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 02 Oct 2008, 06:21
Iremember Jesus back when he played for the Yankees (http://alienlovespredator.com/?id=4).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 02 Oct 2008, 07:16
so fucking cute (http://www.dlisted.com/node/28555)

(http://www.dlisted.com/files/imagecache/photo-preview/files/galleries/rupertdeer3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 02 Oct 2008, 08:05
(http://img.photobucket.com/albums/v40/EvilAP/oedipus.jpg?t=1172274806)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 02 Oct 2008, 08:31
(http://img.photobucket.com/albums/v330/zeejay_djinn/groynes.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 02 Oct 2008, 09:39
(http://i95.photobucket.com/albums/l141/misterroundheels/Starr8.jpg)

he needs a set of hats to go along with
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 02 Oct 2008, 10:35
Whenever you are taking pictures of people, I think everyone wishes that they could time that once in a lifetime shot, don't they?

Oh, and can anyone explain to me wtf they are playing in the last picture?

(http://img.photobucket.com/albums/v438/FocusFlame/1203515993050.jpg)
(http://img.photobucket.com/albums/v438/FocusFlame/1203515999321.jpg)
(http://img.photobucket.com/albums/v438/FocusFlame/1203516558456.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 02 Oct 2008, 10:37
That's footvolleykarateball.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 02 Oct 2008, 12:53
That middle one is great.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 02 Oct 2008, 13:26
(http://i229.photobucket.com/albums/ee300/n1xxa1/n782580301_475871_8647.jpg)

This is the head of 6th form at my school. If you see her outside of school, she is buying alcohol. If you see her in school, chances are she's making a fool of herself.
Last year, she asked my favourite teacher (who was in the middle of teaching history) how lesbians have sex. She knows how men have sex with each other, but could not for the life of her work out the mechanics of women doing it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 02 Oct 2008, 14:15
It looks like she got an idea whilst sucking a lemon...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 02 Oct 2008, 15:54
She seems like someone qualified to run a school
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 02 Oct 2008, 17:25
so fucking cute (http://www.dlisted.com/node/28555)

The followup story. (http://www.dlisted.com/node/28569)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 02 Oct 2008, 17:30
Man, that's saaaaaaaaaaaaaaaaaaaaaaaad
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 02 Oct 2008, 17:56
Joe Hocking: Cold Bastard.

Seriously, Joe, do you enjoy sucking all the joy out of life?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 02 Oct 2008, 18:13
It's the same blog! When I went to the front page because I was curious what sort of blog it is, I noticed the follow up story.

The answer to this question will reveal a lot about you: do you prefer hard truth or comforting lies?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 02 Oct 2008, 18:17
COMFORTING TRUTH AND HARD LIES.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 02 Oct 2008, 19:54
It's the same blog! When I went to the front page because I was curious what sort of blog it is, I noticed the follow up story.

The answer to this question will reveal a lot about you: do you prefer hard truth or comforting lies?

Blissful ignorance.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 02 Oct 2008, 20:54
As long as we're discussing the deaths of cute, furry animals:

(http://i.dailymail.co.uk/i/pix/2008/09/30/article-1064669-02D5EDD700000578-895_468x316_popup.jpg)

(http://i.dailymail.co.uk/i/pix/2008/09/30/article-1064669-02D5F1D000000578-150_468x323_popup.jpg)
(http://i.dailymail.co.uk/i/pix/2008/09/30/article-1064669-02D5F14B00000578-984_468x376_popup.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 02 Oct 2008, 22:36
 :cry:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 02 Oct 2008, 22:51
Don't worry, the stork is just....carrying the little rabbit to some place that is less wet.  Yeah, that's it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 02 Oct 2008, 23:20
I am pretty sure it is more wet inside.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 02 Oct 2008, 23:23
Okay, somewhere warmer then.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 02 Oct 2008, 23:41
so fucking cute (http://www.dlisted.com/node/28555)

The followup story. (http://www.dlisted.com/node/28569)

i bet he would be really nice and tender and delicious
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 03 Oct 2008, 06:35
We got attacked by some sparrows in my D&D game and I considered wild-shaping into a pelican and eating my fill. It was pretty humorous at the time but i guess you'd have to be there.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 03 Oct 2008, 07:14
dear god.

(http://dominantclaw.com/blog/wp-content/uploads/2007/03/geodude.jpg)

what have you wrought, professor oak? WHAT HAVE YOU WROUGHT?

(http://dominantclaw.com/blog/wp-content/uploads/2007/03/koffing.jpg)

OH DEAR CHRIST THE END IS NIGH
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 03 Oct 2008, 08:45
Those have been on the net for a while actually.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 03 Oct 2008, 09:25
(http://fundivision.net/wp-content/uploads/2008/09/unp1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 03 Oct 2008, 09:28
(http://img211.imageshack.us/img211/1003/nevergonnama9.jpg)

*Sigh* Our generation is doomed.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 03 Oct 2008, 09:43
Those have been on the net for a while actually.
Just because those images have been around awhile doesn't make the end any less nigh.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 03 Oct 2008, 10:37
Orbert?

That picture? It is the win.

But people RickRolling a Vice-Presidential debate comes a close second.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 03 Oct 2008, 11:35
I bet non-internet geeks were really touched by that, too.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 03 Oct 2008, 13:20
(http://punditkitchen.files.wordpress.com/2008/09/political-pictures-treasury-department-hearing-fail.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 03 Oct 2008, 13:44
sarah palin porn? (http://www.radaronline.com/exclusives/2008/10/sarah-palin-porn-film.php)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 03 Oct 2008, 18:34
No, this is Sarah Palin porn (http://www.break.com/index/sarah-palin-sex-tape-leaked.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 03 Oct 2008, 20:30
wow....thats...messed up  :-(
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 03 Oct 2008, 20:42
Hey it could have been worse.  It could have been actual Sarah Palin porn.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 03 Oct 2008, 22:07
Hey it could have been worse.  It could have been actual Sarah Palin porn.

( O )___( O )


*shudder* please never say that again
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: parm on 04 Oct 2008, 14:22
C'mon, she was a teen model - there's bound to be a tape somewhere, right?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 04 Oct 2008, 16:07
Pirate Jesus yarrrrrrr!!!!

(http://mattstone.blogs.com/journeysinbetween/images/pirate_jesus.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 04 Oct 2008, 19:57
(http://img247.imageshack.us/img247/4929/depressingpd2.jpg)

(http://img134.imageshack.us/img134/6687/donttryitagainhf4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 04 Oct 2008, 21:12
That is a rather diabolical cat, Blue Kitty
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 05 Oct 2008, 00:07
(http://img.photobucket.com/albums/v12/sademie/simpsons.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Professor Snuggles on 05 Oct 2008, 15:26
Okay so this just gets better as it goes along, and the sound effects totally make it.

http://www.youtube.com/watch?v=REQRHdMRimw

Cat fighting printer.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: fozmo on 05 Oct 2008, 15:30
Nietzsche Family Circus - http://www.losanjealous.com/nfc/ (http://www.losanjealous.com/nfc/)

A few of my favorites:
http://www.losanjealous.com/nfc/perm.php?c=156&q=160 (http://www.losanjealous.com/nfc/perm.php?c=156&q=160)
http://www.losanjealous.com/nfc/perm.php?c=145&q=65 (http://www.losanjealous.com/nfc/perm.php?c=145&q=65)
http://www.losanjealous.com/nfc/perm.php?c=17&q=235 (http://www.losanjealous.com/nfc/perm.php?c=17&q=235)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 05 Oct 2008, 19:28
http://www.losanjealous.com/nfc/perm.php?c=92&q=26 (http://www.losanjealous.com/nfc/perm.php?c=92&q=26)
http://www.losanjealous.com/nfc/perm.php?c=2&q=237 (http://www.losanjealous.com/nfc/perm.php?c=2&q=237)
http://www.losanjealous.com/nfc/perm.php?c=72&q=228 (http://www.losanjealous.com/nfc/perm.php?c=72&q=228)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 05 Oct 2008, 21:16
(http://img401.imageshack.us/img401/5599/catandthingep4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 05 Oct 2008, 22:40
Adorable.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 05 Oct 2008, 23:01
(http://content.humorpix.com/images/2880/p001.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 06 Oct 2008, 03:01
 That is an extremely legit review. The professor/teacher was obviously a humorless fucko.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 06 Oct 2008, 03:47
humorless fucko...hmmm


feh i bet he was a robutt xD
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: axerton on 06 Oct 2008, 06:47
I would have paid good money to see the markers face when they read it though
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 06 Oct 2008, 11:00
Hahaha yeah that wouldve been awesome
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 06 Oct 2008, 14:02
http://www.break.com/usercontent/2008/9/Diesel-SFW-XXX-577249.html

This is about as NSFW as you can get while still remaining somewhat SFW.  Sooooo good.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 06 Oct 2008, 14:06
I think the best thing about that video is I am not at work so now I can just go watch some porn
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 06 Oct 2008, 20:39
Dovey is knee-deep in asian teens anally fisting pregnant milfs as we speak
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 06 Oct 2008, 21:25
yaaaaaaaaaawn yeah it's OK i guess
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 06 Oct 2008, 21:33
(http://img114.imageshack.us/img114/5287/privatepropertyzm1.jpg)

(http://img114.imageshack.us/img114/8224/cutetwofacecatmk1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 06 Oct 2008, 21:38
D:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KharBevNor on 06 Oct 2008, 21:41
D: D: D: D: D: D: D:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 06 Oct 2008, 21:47
Man, I have a friend who threw his puppy a stick and accidentally poked out its eye. So now there's like a four way tie for the saddest thing ever.


If you're wondering what the other two contenders are, it's a retarded man (http://achewood.com/index.php?date=11052001) and finding a wedding dress at the pawn shop.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 06 Oct 2008, 21:51
Everyone.  Stop posting extremely sad things. Seriously
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 06 Oct 2008, 22:06
Love World Of Warcraft style (http://www.somethingawful.com/d/art-of-warcraft/epic-mounts-love.php)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 06 Oct 2008, 23:48
Something happy... (http://www.youtube.com/watch?v=QqGsxwQpa_g)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 07 Oct 2008, 10:17
I find it very hard to be anything but joy when this (http://www.youtube.com/watch?v=z0PGK7a2IFo) is playing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eli on 07 Oct 2008, 14:41
Google mail googles (http://gmailblog.blogspot.com/2008/10/new-in-labs-stop-sending-mail-you-later.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 07 Oct 2008, 17:09
(http://img139.imageshack.us/img139/1718/bunniestx8.jpg)

(http://img515.imageshack.us/img515/6927/givemethebellswe5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 07 Oct 2008, 17:15
They are like the same person!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 07 Oct 2008, 17:28
These first two are completely serious messages from a Protestant website. The second one is a preview of their line of religious comics, it's about satanism.
(http://i137.photobucket.com/albums/q232/scapocy/Feminism.jpg)
(http://i137.photobucket.com/albums/q232/scapocy/ChristIsGod.jpg)

(http://i137.photobucket.com/albums/q232/scapocy/MenInHats4.gif)

And this is my kitty, Karma. Sorry for the size.
(http://i137.photobucket.com/albums/q232/scapocy/EveryonesDrunk015.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 07 Oct 2008, 17:40
Yum Chick comics. Gotta love those. I know I do.
(http://s10.photobucket.com/albums/a127/r3an1m4t3d/SHOOPDACHICK.jpg)

(http://s10.photobucket.com/albums/a127/r3an1m4t3d/?action-view&current=Gimmeahellyeah.jpg)

Hell yeah!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Professor Snuggles on 07 Oct 2008, 17:46
(http://cache.daylife.com/imageserve/09bQ1BraZ88Mz/340x.jpg)

(http://cache.daylife.com/imageserve/03zh6kSd6HbSu/610x.jpg)

(http://i34.tinypic.com/24v2qt2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 07 Oct 2008, 18:22
the benches change color. Fail


Though, I love Obama.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 07 Oct 2008, 18:44
Obama will sit down and talk with the true menace to our society
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 07 Oct 2008, 18:45
He's doing it right now on Fox.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 07 Oct 2008, 19:53
 :-D - ZING
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Professor Snuggles on 07 Oct 2008, 20:00
the benches change color. Fail


Though, I love Obama.

You don't get it, huh
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 07 Oct 2008, 22:04
Three years ago, I became Internet Famous, and didn't even know it... (http://www.jeriwho.net/lillypad2/2005/09/have-spent-last-day-trying-to-explain.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Professor Snuggles on 07 Oct 2008, 22:45
(http://i38.tinypic.com/25i15q0.jpg)





(http://i38.tinypic.com/315lxnd.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ImRonBurgundy? on 07 Oct 2008, 23:02
(http://Obama wink)

"I'm calling to publicly apologize for messing up your game.  I read that; I felt terrible.  I didn't know there were any ladies around.  I just wanted to let you know that I'm deeply sorry."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 08 Oct 2008, 00:54
the benches change color. Fail


Though, I love Obama.

You don't get it, huh


Wow. I am thinking you don't get it.

I was joking. I was giving you shit because the two benches change color. But you know, you can be an ass, that is fine too.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Lummer on 08 Oct 2008, 03:23
http://www.youtube.com/watch?v=ufMdo9AyMng

 :-(

Okay, that seriously had me crying my eyes out. Such a beautiful song  :cry:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 08 Oct 2008, 05:48
this (http://www.youtube.com/watch?v=XEgn3kClWGs) creepy shit is here especially for tommy, who i love dearly.

fucking monkey waiters
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 08 Oct 2008, 06:01
Oh man I saw that on the news last night! It is the best/raddest/cutest/most wonderful thing
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 08 Oct 2008, 13:12
Feminism Piccy

I have to get a "this is what is what a machoist looks like" shirt just like the woman in front.

 :-D--how many stares will i get?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 08 Oct 2008, 13:50
You mean 'masculist'?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 08 Oct 2008, 13:53
I want one that says
SATANISM:
I REALLY DIG THE POWER!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Professor Snuggles on 08 Oct 2008, 14:11
You mean 'masculist'?

I bet he meant misogynist.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 08 Oct 2008, 19:00
this (http://www.youtube.com/watch?v=XEgn3kClWGs) creepy shit is here especially for tommy, who i love dearly.

fucking monkey waiters

At first I thought it would be really creepy, but I was thinking of Chimpanzees, not those awesome little guys.

(http://img160.imageshack.us/img160/9900/grmlockforchangecm8.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 08 Oct 2008, 22:23
Sometimes I like to waste time on wikipedia. I thought this (http://en.wikipedia.org/wiki/American_English) was interesting.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 09 Oct 2008, 00:39
I'm using the cat brush! (http://www.youtube.com/watch?v=ySGtniX4QrU)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 09 Oct 2008, 04:47
I love that song.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 09 Oct 2008, 11:39
I find it very hard to be anything but joy when this (http://www.youtube.com/watch?v=z0PGK7a2IFo) is playing.

They are entirely and totally my favourite band. Please do try and find their albums, because they are excellent. This is one of their more light-hearted numbers, but they are also marvellous live, and play some fairly dark yet soulful stuff.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 09 Oct 2008, 16:37
I don't think anyone has posted this yet...
Barack Roll'd? (http://www.youtube.com/watch?v=65I0HNvTDH4)
But this one is funnier, I think  (http://www.youtube.com/watch?v=_TiQCJXpbKg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 09 Oct 2008, 22:17
(http://s10.photobucket.com/albums/a127/r3an1m4t3d/awesome-1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 09 Oct 2008, 23:09
Who is that.  I don't get it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 09 Oct 2008, 23:36
It sure is pointless
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 10 Oct 2008, 01:45
INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8) INTERIOR CROCODILE ALIGATOR, I DRIVE A CHEVROLET MOVIE THEATER (http://www.youtube.com/watch?v=iwyC2PW3vc8)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 10 Oct 2008, 02:28
Who is that.  I don't get it.

It was an ad on my myspace homepage. I thought it was funny that she was 16 and making 16k a month. I only know one profession where a 16 year old girl could make that much.

Protip: She's a whore.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 10 Oct 2008, 09:22
WHY? (http://www.youtube.com/watch?v=76B4hG_wLJs)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 10 Oct 2008, 11:12
I thought that was like...last year.  Still, I totally dig the suit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 10 Oct 2008, 11:29
this is coo/terrifying in some ways

http://video.google.com/videoplay?docid=5349770802105160028

it reminds me of something from silent hill, a little
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thaes on 10 Oct 2008, 11:39
Moores hat is the coolest piece of clothing Ive seen in a while.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: maxusy3k on 10 Oct 2008, 11:43
this is coo/terrifying in some ways

http://video.google.com/videoplay?docid=5349770802105160028

it reminds me of something from silent hill, a little

Oh man the legs freak me out so bad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 10 Oct 2008, 12:02
this is coo/terrifying in some ways

http://video.google.com/videoplay?docid=5349770802105160028

it reminds me of something from silent hill, a little

Anyone else think of the daleks while they watched this?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CamusCanDo on 10 Oct 2008, 15:36
WHHHHHHHHHHY??? WHHHHHHY?? (http://www.youtube.com/watch?v=v2fJtG8VI3A)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 10 Oct 2008, 15:40
That is one of the stranger things I have seen on Youtube.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 10 Oct 2008, 16:01
(http://cassland.org/images/IntelligentDesign.jpg)

(http://cassland.org/images/Universe.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 10 Oct 2008, 17:22
(http://img524.imageshack.us/img524/8782/itbeginsbx3.jpg)

Stork Patrol (http://www.youtube.com/watch?v=rH9giCg3Nro)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 10 Oct 2008, 18:08
(http://5.media.collegehumor.com/collegehumor/ch6/9/a/collegehumor.5b6429297b0596c6667f16da849f630b.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ImRonBurgundy? on 11 Oct 2008, 03:40
I saw that earlier today.  The thing looks like two sets of disembodied human legs dancing at each other.

But as freaky as it looks, and as much as I know it is a machine with no feelings, why do I feel sorry for it when the dudes kick it?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 11 Oct 2008, 04:24
Huh? Are you talking about Ann Coulter?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 11 Oct 2008, 07:05
He's talking about the quadruped robot. Which I'm pretty sure has been posted on this forum before multiple times; I'm surprised it's evidently new to a lot of you.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 11 Oct 2008, 07:47
Yay sig quote.

That Hillary thing is horrible.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ImRonBurgundy? on 11 Oct 2008, 14:29
I did not quote, because I was drunk.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 12 Oct 2008, 03:29
(http://i36.tinypic.com/b7mnhe.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tommydski on 12 Oct 2008, 04:47
this (http://www.youtube.com/watch?v=XEgn3kClWGs) creepy shit is here especially for tommy, who i love dearly.

fucking monkey waiters

No No No NO NO NO.

FUCKEN MONKEYS.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cernunnos on 12 Oct 2008, 15:21
http://news.bbc.co.uk/1/hi/sci/tech/7665747.stm
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 12 Oct 2008, 15:41
whoa.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 12 Oct 2008, 15:44
Holy shit that's amazing
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 12 Oct 2008, 15:46
Brilliant!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 12 Oct 2008, 17:39
Don't shoot the puppy (http://www.rrrrthats5rs.com/games/dont-shoot-the-puppy/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 12 Oct 2008, 17:49
link be broken.

(or somethin)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 12 Oct 2008, 18:00
Ok, guys, so I am on this dating site. It is quite possibly one of the funniest sites in the world. Also, the terrible person troll in me loves it, because it's easy to argue with people on there. The cynical bitter spinster in me also loves the place because it makes me feel like I am right for my bitterness. Anyway, tonight I came across this little gem

(http://i137.photobucket.com/albums/q228/andlemonade/profaneandviolent.jpg)


Why do people think this is an appropriate response to rejection? Also, hahahaha that guy is a loser.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 12 Oct 2008, 18:01
Man, that guy is so kooooooooooooooooooooooooool
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 12 Oct 2008, 18:04
for all of ten seconds I felt a little bad for the guy, and then I just started laughing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 12 Oct 2008, 18:08
Also, what the hell does "1/2 bread" mean.

Although, it's probably a misspelling, considering such gems as "borader", "enought", and "sucken"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Edith on 12 Oct 2008, 18:09
Dude's got a point, though. I mean, she could have messaged him back. If she wasn't such a bitch.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 12 Oct 2008, 18:15
I assume he's trying to say "Get your half-breed ass back across the border," so perhaps she's white Hispanic? I could be wrong; I don't speak sexually frustrated asshole.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 12 Oct 2008, 18:16
Also, what the hell does "1/2 bread" mean.

Although, it's probably a misspelling, considering such gems as "borader", "enought", and "sucken"


I think it is "half breed/bred"


If see would have messaged him back, I am fairly certain the results would have been the same. Lately, it seems like every time I respond to someone saying I am uninterested, I get some sort of hatemail back. I recent, politely, rejected some dude, and he messaged back with a very detailed list of why everything in my profile is wrong and bad. He went on and on about how one of my favorite writers is a "fag" who I only like because "every fucking scene girl likes him, and the New York Times says you should like him, and you think it makes you look smart." I wasn't aware that scene girls liked David Sedaris.

I tend to just respond with "Man up and move on."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 12 Oct 2008, 18:32
It's a shame that logic and politeness aren't regular features in all people.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 12 Oct 2008, 18:44
I've decided my favorite part of rants like that one is how the author almost invariably use the terms slut and whore to describe a woman who won't sleep with them, which hits me as a bit oxymoronic. I mean, really, is going the extra mile and calling them a cock tease or a frigid bitch really that hard? At least it would make a misguided sort of sense. Furthermore, it hits me as kinda self-defeating as well. I can totally see how you could build up so much perv-rage if you really think all women are sluts and thus believe that you're incapable of closing the deal even with random internet skanks.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 12 Oct 2008, 19:34
 The guy that typed that is a fagett
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 12 Oct 2008, 19:39
Whipsticth, that would assume that the man behind that message actually has intelligence and can form coherent sentences
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tommydski on 12 Oct 2008, 19:45
Dude's got a point, though. I mean, she could have messaged him back. If she wasn't such a bitch.

This is probably my favourite post in this whole thread.

I legitimately laughed for all kinds of reasons.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 12 Oct 2008, 19:49
So, I'm on that same site, I actually signed up to see if I could meet someone from there before my friend could. Just to show him up for fun. I actually would love a response back saying "eh, no thanks" because then I'd know not to wait for a response. Then again, I'm not some crazy asshole who thinks that girls in real life are like the girls in the porno movies.

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 12 Oct 2008, 19:53
The dude had a legitimate grievance but anybody who thinks that is an appropriate way to address it has obvious psychological problems.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 12 Oct 2008, 20:56
You guys have to understand though, as much as guys would like "Not interested," when girls send them, they get these messages. After awhile of getting the same treatment, why would anyone want to do it again?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 12 Oct 2008, 21:48
(http://a757.ac-images.myspacecdn.com/images01/34/l_61b264e25a643b1c3db5420096ff64b4.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 12 Oct 2008, 22:36
The dude had a legitimate grievance but anybody who thinks that is an appropriate way to address it has obvious psychological problems.

You guys have to understand though, as much as guys would like "Not interested," when girls send them, they get these messages. After awhile of getting the same treatment, why would anyone want to do it again?

I imagine Dovey doesn't mean to imply that guys like this have a serious grievance. I'd put someone who doesn't respond to messages on a dating site in the same category as a stranger who doesn't bother to acknowledge you in the least when you greet them politely or hold a door open for them; it's a touch insensitive, but they don't really owe you anything and you're most certainly out of line the second you start spewing hateful bile about them. Pointing out that someone is being rude is often a greater breach of etiquette than committing a transgression in the first place, after all, so acting like a stark raving lunatic like this asshat did just takes us back to Dovey's original point: the dude is crazy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 12 Oct 2008, 23:37
Mm, yes, that. What he said.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 13 Oct 2008, 00:02
Whenever I see something like that, I have the largest urge to proof-read and edit it. Get rid of all the "could of"s and "your"s and replace them with "could have" and "you're". Fix up the punctuation mistakes. But, really, there's no point. Dude like that isn't going to learn.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 13 Oct 2008, 00:21
True story:

Once in high school, my first "serious boyfriend" cheated on me. When I found out, we broke up. The following weeks he tried to get me back, by giving me a series of notes. I got so annoyed with his constant note writing, that eventually, I just started correcting all his grammar and spelling errors and handing them back.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 13 Oct 2008, 02:24
True story:

Once in high school, my first "serious boyfriend" cheated on me. When I found out, we broke up. The following weeks he tried to get me back, by giving me a series of notes. I got so annoyed with his constant note writing, that eventually, I just started correcting all his grammar and spelling errors and handing them back.

Be my girlfriend, please.
I have done that to people before. It is sooooooooo excellent to see the look on their face when they realize you've taken the hateful bile that they have spewed onto paper and created a coherent letter that makes them not look like a douche.


On the topic of sending 'no thanks' and acknowledging strangers:
I think if someone sends the message saying "hey, whats up" and there is no response, whatever, who cares, its like real life, you say that to someone in person mostly they'll say, "hey not much, you?" as they're walking by and not even wait for your response.
But when you take the time to write out a pretty sizable message to someone, showing that you took time out of your day to actually read what they have written rather than look at the pictures and go 'she hot, i wana fuk her' I think that can deserve a response. Of course, I'm a grammar nazi a lot so I don't often respond to people who TALK LIKE THIS, LiKe ThIs, or lik dis. But if they seem like they're at least a little smart, I'll talk to them.
The truth of the matter is that on those sites, most of the girls are getting 10x more email than the guys. That's just how it works, the guys will send out bunches of emails and hope that just one or two of the girls respond, because most of them don't respond. Hell, I've even been of the mindset that even if it doesn't look like we could have a relationship, lets at least be friends, the Phoenix Valley is a damn big place, you never know what part of town you might end up in when you need a friend. I could have probably not gone on so long with this, but WHATEVER DUDE, JACE IS TIRED OF NEVER HAVING RELATIONSHIPS OKAY.

tl;dr: Jace is disgusted with how online dating works.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 13 Oct 2008, 03:06
Looking at the horror that is online dating makes me very happy to be married.
I need to go let my wife know I love her very much, and I'm glad we met the old-fashioned way.

...getting way too drunk with each other at a party.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 13 Oct 2008, 04:34
Things were so much simpler back in my day. If a girl liked the look of you then she'd just bash you over the head and drag you off to meet her parents. If you had a problem with that... Well, you probably weren't interested in girls to begin with. The Intarwubs have a lot to answer for.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 13 Oct 2008, 09:41
(http://a757.ac-images.myspacecdn.com/images01/34/l_61b264e25a643b1c3db5420096ff64b4.gif)

guys. not enough random. go start your own thread.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 13 Oct 2008, 10:53
Robin Williams on the shitter was probably the best image to put in the middle of that discussion. Nice work, Tragic Pizza.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 13 Oct 2008, 11:33
I saw that picture about three times before I realized it was actually a video clip.

And now for something completely different
http://www.flickr.com/photos/titanas/2928595405/sizes/o/ (http://www.flickr.com/photos/titanas/2928595405/sizes/o/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 13 Oct 2008, 13:06
I see your Iceland and raise you a New Zealand

http://tvnz.co.nz/view/page/411365/712869 (http://tvnz.co.nz/view/page/411365/712869)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 13 Oct 2008, 13:10
real estate has really become competitive in this market.

Possibly key for Obama win? (http://www.theonion.com/content/video/gunman_kills_15_potential_voters)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Misereatur on 13 Oct 2008, 13:10
Fuck (http://www.e-dologic.co.il/shofar/) Guitar Hero.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RobbieOC on 13 Oct 2008, 13:16
(http://xs120.xs.to/xs120/07431/conanshufflexy9.gif) (http://xs120.xs.to/xs120/07431/conanshufflexy9.gif) (http://xs120.xs.to/xs120/07431/conanshufflexy9.gif) (http://xs120.xs.to/xs120/07431/conanshufflexy9.gif) (http://xs120.xs.to/xs120/07431/conanshufflexy9.gif) (http://xs120.xs.to/xs120/07431/conanshufflexy9.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WelshPete on 13 Oct 2008, 13:55
(http://i160.photobucket.com/albums/t173/WelshPete/knuttz_ueba_36.jpg)

(http://i160.photobucket.com/albums/t173/WelshPete/knuttz_ueba_29-2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 13 Oct 2008, 21:43
I feel in an odd mood today

(http://img378.imageshack.us/img378/2654/spidergirlpj3.jpg)(http://img395.imageshack.us/img395/842/spidergirl1qp9.jpg)
(http://img395.imageshack.us/img395/3427/spidergirl2mb3.jpg)(http://img395.imageshack.us/img395/3221/spidergirl3dc8.jpg)
(http://img134.imageshack.us/img134/4849/spidergirl4lb3.jpg)(http://img134.imageshack.us/img134/1069/spidergirl5dg4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 14 Oct 2008, 02:06
DAMNIT KITTY.

Now I'm all sad. D:

And slightly horny for Spiderman.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eli on 14 Oct 2008, 04:32
(http://mfrost.typepad.com/cute_overload/images/2008/10/13/2461745299_4852221ec5_b.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 14 Oct 2008, 06:20
...That...that is awesome.

As per Spiderman: Goddamn, that makes it so hard to hate him...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 14 Oct 2008, 06:23
Aww... and now I have to write a paper before noon... I think I'm going to cry.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 14 Oct 2008, 10:51
(http://i278.photobucket.com/albums/kk92/_beatingheartsbaby/39ebee468163b82dcec0e26acf64a9d95d9.jpg)

Normally I would think this is below the belt, but Sarah Palin really needs a cunt punt.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 14 Oct 2008, 10:54
WHYYYYYY???? (http://www.foxnews.com/story/0,2933,434043,00.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 14 Oct 2008, 11:18
You want cosmically unfair? A British convicted rapist, out on day-release as part of his parole program, bought a lottery ticket and won something like 7 million.

And people ask me why I chose Atheism.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 14 Oct 2008, 12:01
I thought you said "comically unfair." That wording sounds better to me.


re: spider man on previous page: They've done that sort of tugging-the-heartstrings thing a couple times. I have a Spiderman comic where he reveals his identity to a kid dying of cancer.


ADDITION: I'm not sure why I was surprised when that story was easy to track down for confirmation -
http://www.guardian.co.uk/uk/2004/aug/11/ukcrime.lottery
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 14 Oct 2008, 14:38
Found this gem!
(http://i137.photobucket.com/albums/q232/scapocy/FSM.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 14 Oct 2008, 15:02
I followed a car with a FSM sticker on the back today.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 14 Oct 2008, 15:12
@Jeans
Have you ever read the hate mail section?

Quote
Have fun with your nonsense because I am going to destroy all that crap you people spread. There hasnt been a single evolutionist or atheist that has won or ever will win against me. Dont believe me, see how many forum discussions on evolution that you can find on aol. Check out Adrienne Currys blog. I just started there but thats just for fun. If darwin knew of me, he would have never come up with ridiculous theory that doesnt have a single gram of sense in it. I will single handily take on any and all evolutionist and atheists in a nationally televised public forum, discussing evolution. And I will single handidly win. So enjoy it while it lasts, because it wont last much longer.

-The Asetrian

And, at least for the first couple of pages, nobody even suggested it was a troll in the replies.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 14 Oct 2008, 15:18
Guitar Boat!

(http://cache.gawker.com/assets/images/gizmodo/2008/10/josh-pykes-boat-guitar.jpg)

more pictures and stuff (http://gizmodo.com/5061738/josh-pykes-guitar-boat-floats-on-an-ocean-of-rock)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 14 Oct 2008, 16:41
today i saw a t-shirt with a picture of Barack Obama on it that said "Black to the Future" in the same font from Back to the Future.

i wish i had a camera with me so i could have taken a picture because it was pretty cool.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 14 Oct 2008, 17:01
that's actually what i thought at first too so i walked over and looked closer, and lo' and behold: it actually said "black."
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 14 Oct 2008, 20:03
Continuing the theme from last night, though this one isn't as sad.

(http://img525.imageshack.us/img525/130/loves1ch0.jpg)(http://img525.imageshack.us/img525/6791/loves2ts5.jpg)
(http://img248.imageshack.us/img248/3834/loves3ry2.jpg)(http://img248.imageshack.us/img248/8539/loves4zh5.jpg)
(http://img248.imageshack.us/img248/8847/loves5hf5.jpg)

I found two more like these, including the one I think Joe was talking about.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 14 Oct 2008, 20:37
Why are there so many "dead kids love Spiderman" comics?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 14 Oct 2008, 20:56
Because hating on Spiderman would be hating on the last wishes of tiny children. You don't hate the dreams of tiny children, do you?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 14 Oct 2008, 21:32
Well the Conservatives did just win the election.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 14 Oct 2008, 22:41
Quote
FSM bullshit

Sometimes I really wanna beat the fuck out of my friend Tom for this bullshit. Normally, I don't care about religions or any of that, but he takes it too far. I mean, he's in college and he dressed up as a pirate on a friday, then wonders why he feels like he doesn't fit in. Also, he takes the shit way too seriously, and I just get frustrated and change the subject. The whole thing just pisses me the fuck off. Now I'm all downed and in a mood to rage, but also be sad because dying kids love spiderman and spiderman is a cool dude.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 15 Oct 2008, 00:09
Why are there so many "dead kids love Spiderman" comics?

Because they are awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 15 Oct 2008, 00:35
spiderman is a cool dude.

eh hangs out with dying kids and doesn't afraid of anything
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 15 Oct 2008, 05:33
LOL! God, that was so perfect. Thanks for the lulz, Oz.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 15 Oct 2008, 07:36
spiderman is a cool dude.

eh hangs out with dying kids and doesn't afraid of anything

Teamwork!  :-D
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 15 Oct 2008, 11:27
This looks severe.
(http://i5.photobucket.com/albums/y176/insanity4free/midgets.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 15 Oct 2008, 11:39
(http://candykirby.com/wp-content/uploads/2008/10/badadplacement.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 15 Oct 2008, 11:46
Its like, I want to call down the wrath of the b folder, but at the same time, I just don't want to upload all those images.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 15 Oct 2008, 13:12
This has become MORBID THREAD.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 15 Oct 2008, 13:32
i like the spiderman one,and the midgets are funny too
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 15 Oct 2008, 13:48
This has become MORBID THREAD.

Oh man, that is almost an excellent idea...except, that would be really disturbing too.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 15 Oct 2008, 13:51
Can you guess who?

(http://img201.imageshack.us/img201/7201/iknowwhoyouaresz4.png)

(http://img201.imageshack.us/img201/2387/jaygarrickbc6.jpg)

(http://img377.imageshack.us/img377/3401/realmonstershg0.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 15 Oct 2008, 14:41
(http://www.fanboys-online.com/comics/20080930.jpg)
Big Picture, sorry.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 15 Oct 2008, 14:45
Fail.

Or maybe
ur doing it wrong.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 15 Oct 2008, 15:16
This has become MORBID THREAD.

Oh man, that is almost an excellent idea...except, that would be really disturbing too.
Yeah, don't need this place turning into gurochan.

Warning! DO NOT look up gurochan if you have no idea what I'm talking about. In this instance, ignorance is bliss.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 15 Oct 2008, 15:20
Can you guess who?

The first couple are the Rescuers. I have no idea who the rest are.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 15 Oct 2008, 15:25
I think the last ones are Ickus, Oblina, and Krumb, from Ahhhh!!! Real Monsters.


Maybe.


I am probably wrong.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Abyssion27 on 15 Oct 2008, 15:47
The elderly middle couple would be Peter Pan and Wendy. If I'm correct.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 15 Oct 2008, 15:48
Peter Pan wears red?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 15 Oct 2008, 16:58
I totally got that the first one was Bianca and Bernard (is that their names??), and that the second one was aged-Peter and Wendy, but I still don't get the last one the more I look at it...
Matt, you make things too hard.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 15 Oct 2008, 17:16
Second one is aged Spider-Man and whatshername.

Also:

(http://www.spockwithabeard.com/community_uploads/old_sport/apple.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 15 Oct 2008, 17:38
People need to learn to check picture properties. The second photo was Jay Garrick (The original Flash) and his wife.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 15 Oct 2008, 17:56
Oh, well. How... fascinating?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 15 Oct 2008, 19:17
1). The Rescuers (probably the easiest one)
2). Jay Garrick (the first Flash as Obsessions said) and his wife (made this one easier with the name since I don't think many people know who he was)
3).  The Ahh Real Monsters main characters, Ickus, Oblina, and Krumb
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 15 Oct 2008, 19:52
(http://i220.photobucket.com/albums/dd128/tattarattat/Liberman-Heartbreak.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 15 Oct 2008, 19:54
EPIC WIN.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: axerton on 16 Oct 2008, 00:18
3).  The Ahh Real Monsters main characters, Ickus, Oblina, and Krumb

(http://i94.photobucket.com/albums/l120/axerton/cast.jpg)
?? confused.

Also just for fun.
(http://i94.photobucket.com/albums/l120/axerton/intat11.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 16 Oct 2008, 09:57
I am sure alot of you have seen this already.

Rolling Bomber Special Remastered.  Better video quality than past uploads.

http://www.youtube.com/watch?v=W2BBl7_-4JA
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 16 Oct 2008, 15:32
(http://www.pe.com/imagesdaily/2008/10-16/racist16_400.jpg)

"No racist intent" (http://www.salon.com/wires/ap/2008/10/16/D93RP68G0_obama_illustration/index.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 16 Oct 2008, 16:15
Diane Fedele, president of the group, said she had no racist intent.

"I never connected," she told the newspaper. "It was just food to me. It didn't mean anything else."


...what?  So you just *happen* to choose an image filled with food associated with black stereotypes?  Like EVERY SINGLE food item that is associated with racist black stereotypes???
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 16 Oct 2008, 16:19
Or for that matter, why any food items at all? That's what I was wondering when I read her statement: "If it wasn't due to racist intent, then what was the intent?"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 16 Oct 2008, 21:23
Or for that matter, why any food items at all? That's what I was wondering when I read her statement: "If it wasn't due to racist intent, then what was the intent?"
To make sure you KNOW it was a food stamp. It can't just say it, it has to SHOW it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 16 Oct 2008, 22:36
(http://i186.photobucket.com/albums/x59/LouBriccant/Part%202/ayaya-o.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 17 Oct 2008, 14:25
Now, I love cats, right?

Who doesn't love cats?

But seriously, looking at this picture made me feel all blurgh:

(http://www.stuffonmycat.com/images/stories/20081017_macrovision.jpg)

I MEAN SERIOUSLY, look at all those tiny little hooks on that tongue.

Go on, look closer.

LOOK AT THEM.

Does that not look horrible and disguisting to anyone else?

But yeah, I got it from here: http://www.stuffonmycat.com/ (http://www.stuffonmycat.com/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 17 Oct 2008, 15:19
How did you think they managed to clean themselves?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 17 Oct 2008, 15:27
What we are looking at is the cat's hair brush and toilet paper. Think about that next time your cat licks your face.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scandanavian War Machine on 17 Oct 2008, 16:00
still probably cleaner than a human hand
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 17 Oct 2008, 16:12
Lets not forget that saliva contains anti-bacterial compounds.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 17 Oct 2008, 16:33
(http://img384.imageshack.us/img384/277/dinosaurkillerjh3.png)

(http://img384.imageshack.us/img384/8625/bananamanmk7.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 17 Oct 2008, 16:39
(http://facweb.furman.edu/~rbryson/BananaMan/BManGraphics/ARobinsSpangles.jpg)

banana theme anyone?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 17 Oct 2008, 23:09
CAT TONGUE

No, man, that is cool. I wish we had tongues like that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 18 Oct 2008, 00:20
I imagine a tongue like it would make french kissing a lot more interesting.

But I still regard the miniture-tenticle like things as being NAAAAAASSSTYYY.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 18 Oct 2008, 00:54
(http://upload.wikimedia.org/wikipedia/commons/thumb/2/27/Banana_slug_at_UCSC.jpg/800px-Banana_slug_at_UCSC.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 18 Oct 2008, 00:57
(http://upload.wikimedia.org/wikipedia/commons/thumb/1/1f/Mating_Great_Grey_Slug_4111.jpg/450px-Mating_Great_Grey_Slug_4111.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 18 Oct 2008, 01:00
(http://members.optushome.com.au/awnelson/davidavid/slug/1.jpg)(http://members.optushome.com.au/awnelson/davidavid/slug/2.jpg)(http://members.optushome.com.au/awnelson/davidavid/slug/3.jpg)(http://members.optushome.com.au/awnelson/davidavid/slug/4.jpg)(http://members.optushome.com.au/awnelson/davidavid/slug/5.jpg)(http://members.optushome.com.au/awnelson/davidavid/slug/6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 18 Oct 2008, 01:05
(http://www.naturamediterraneo.eu/Public/data5/cmb/Limax-KOP-Ausschnitt%20Forum.jpg_2007912235937_Limax-KOP-Ausschnitt%20Forum.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: turnipsquid on 18 Oct 2008, 01:12
these snails are freaking me the fuck out.



also: Michael Chertoff. The man's name was stuck in my drunken head all night and *finally* I have access to Wikipedia. whyyyyyyyyyyyy, get out of my head chertoff
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 18 Oct 2008, 02:51
So those slugs (snails? slugs? whichever). What are they doing?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 18 Oct 2008, 03:10
Gesundheit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: october1983 on 18 Oct 2008, 03:18
So those slugs (snails? slugs? whichever). What are they doing?

Well, you see, when a mummy slug and a daddy slug love each other very much...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 18 Oct 2008, 06:14
(http://img262.imageshack.us/img262/2358/27mcmegatronsgq3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 18 Oct 2008, 06:27
That's pretty bad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 18 Oct 2008, 06:43
Bad as in what youth of today say when they mean good?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 18 Oct 2008, 08:55
You mean youth in the late 90's?
Fixed it for ya
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 18 Oct 2008, 12:22
(http://photos-e.ak.facebook.com/photos-ak-snc1/v349/57/72/690967928/n690967928_899644_6580.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 18 Oct 2008, 12:30
MAVRIKS 2 THE DEAF
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 18 Oct 2008, 12:31
At least they spelt Obama right?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 18 Oct 2008, 12:41
So those slugs (snails? slugs? whichever). What are they doing?

Well, you see, when a mummy slug and a daddy slug love each other very much...

Actually, they're hermaphrodites but at that stage they're both acting as the "daddy".
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 18 Oct 2008, 16:00
(http://www.wherearethedogshumping.com/musician-meetup.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 18 Oct 2008, 16:22
Dude why do you think they were called "The Bad Brains".

Why do people think we're the same person?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 19 Oct 2008, 01:52
First thing I thought when I saw that pic was that the fucker needs to learn trigger discipline.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 20 Oct 2008, 00:03
I am not entirely sure how far to take this lesson to heart. (http://www.youtube.com/watch?v=K88yBMzm4Dc)

I will say that I found this video via experimental mime.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 20 Oct 2008, 00:41
"What some of you may not know is that Barack is actually Swahili for 'That One'" (http://news.bbc.co.uk/2/hi/americas/7675927.stm)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 20 Oct 2008, 02:10
This man (http://www.youtube.com/watch?v=9Y_CGB1GuoI) is a genius.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 20 Oct 2008, 07:38
(http://www.lefthandedtoons.com/toons/justin_hugbag.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 20 Oct 2008, 20:21
(http://www.comicbookresources.com/images/litg/2008/1020/44897Superman-max.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 20 Oct 2008, 22:34
(http://cache.gawker.com/assets/images/kotaku/2008/10/503884316da15916394a41a68321ca97.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 21 Oct 2008, 00:33
(http://i34.tinypic.com/10h6gdd.gif)
What a way to celebrate my 1,000th post...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 21 Oct 2008, 13:06
(http://www.hookiedookiepanic.com/geist/forum/download/file.php?id=64)
Fail
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 21 Oct 2008, 13:22
Slow
Poke
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Storm Rider on 21 Oct 2008, 16:57
MOAR CRAP
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Spike on 21 Oct 2008, 17:23
(http://img134.imageshack.us/img134/4679/mariofireballsfr1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 21 Oct 2008, 17:36
Kinda similar to that Mastodon comic a while back except not nearly as awesome
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 21 Oct 2008, 17:37
MOAR CRAP

(http://i137.photobucket.com/albums/q232/scapocy/McCain.jpg)

fixedorz
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 21 Oct 2008, 19:02
MCCAIN THE BURNINATOR!!!!!

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 21 Oct 2008, 22:43
(http://img504.imageshack.us/img504/5003/mariokartqn8.png)

(http://img519.imageshack.us/img519/421/silenthilldo6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 21 Oct 2008, 23:02
"The Bolsheviks? GUFFAW!!"
(http://img528.imageshack.us/img528/5613/t34cleningradmg6.jpg) (http://imageshack.us)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 21 Oct 2008, 23:20
http://www.youtube.com/watch?v=ubnHR1JsPtA
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 21 Oct 2008, 23:21
This guy's gonna get an ass full of pipe wrench. (http://www.youtube.com/watch?v=8HE9OQ4FnkQ)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 21 Oct 2008, 23:51
Ah, back when it first came out that original video was awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 22 Oct 2008, 11:40
Guys guys guys I saw this book (http://www.amazon.com/Can-Has-Cheezburger-LOLcat-Colleckshun/dp/159240409X) at Waldenbooks yesterday.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thaes on 22 Oct 2008, 11:44
I'm so gonna buy that when it comes out around here.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 22 Oct 2008, 12:00
look at this and laugh

http://www.youtube.com/watch?v=Gs-fVj_PT5o (http://www.youtube.com/watch?v=Gs-fVj_PT5o)-NSFWish

I recognize at least 5 of the animes featured

Edit: Never mind i see seven, i need to get a life
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 22 Oct 2008, 12:44
http://sadguysontradingfloors.tumblr.com/
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 22 Oct 2008, 13:28
'i think our kitty is dead' (http://www.poetv.com/video.php?vid=26256)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 22 Oct 2008, 14:35
http://sadguysontradingfloors.tumblr.com/

Oh man, all three other people in my house work at the Chicago Mercantile Exchange and they come home depressed all the time.

Also, dead kitty made me laugh out loud.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 22 Oct 2008, 22:26
(http://i133.photobucket.com/albums/q59/Woodo426/inb4/1210761672021.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 22 Oct 2008, 23:25
No fucking way. Is that real? I really cant decide. Either way, I lol'd.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: maxusy3k on 22 Oct 2008, 23:30
It is probably real, I've heard of similar things many, many times.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 23 Oct 2008, 01:13
A real solution to the economic crisis (http://www.youtube.com/watch?v=XuUeOY4Gk5o)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 23 Oct 2008, 01:34
(http://cassland.org/images/ATM-activation.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 23 Oct 2008, 02:08
I didn't know that this happened. (http://www.youtube.com/watch?v=3lhomInJ7Pc)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 23 Oct 2008, 03:51
I liked this Sinfest.

(http://sinfest.net/comikaze/comics/2008-10-23.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 23 Oct 2008, 04:31
(http://img.photobucket.com/albums/v12/sademie/facelulz.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 23 Oct 2008, 12:17
http://www.youtube.com/watch?v=Bt7YCnCYtmg&eurl=http://www.g4tv.com/thefeed/blog/post/689621/Election_Game_RoundUp.html (http://www.youtube.com/watch?v=Bt7YCnCYtmg&eurl=http://www.g4tv.com/thefeed/blog/post/689621/Election_Game_RoundUp.html)

Obama vs McCain via Soul Calibur IV

Someone had some time on their hands.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 23 Oct 2008, 13:26
I would buy soul calibur for that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 23 Oct 2008, 14:19
(http://img385.imageshack.us/img385/7296/parahsailing221oy7.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 23 Oct 2008, 14:50
A real solution to the economic crisis (http://www.youtube.com/watch?v=XuUeOY4Gk5o)

I was gunning for makeouts but this was just as good.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 23 Oct 2008, 15:43
Where was that picture of Andy Samberg with the gun from?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 23 Oct 2008, 15:54
http://www.youtube.com/watch?v=ubnHR1JsPtA

That.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Spike on 23 Oct 2008, 17:06
http://www.thelocal.se/15138.html (http://www.thelocal.se/15138.html)

Quote
Wed also heard mention of it, but we decided that it would only be worse if we went out and told the fans they were absolutely not allowed to throw dildos on the ice, said AIK club head Mats Hedenstrm to the newspaper.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 23 Oct 2008, 17:44
Oh, man this thread has gotten so much better as of late. I was almost ready to write it off.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 23 Oct 2008, 18:14
This is the sequel to the longest lived thread on QC. It's been around so long it has cycles.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 23 Oct 2008, 19:15
Hey you guys what is up here is a photo of a cool spider.

(http://www.cairns.com.au/images/uploadedfiles/editorial/pictures/2008/10/23/birdy2usu.jpg)

more here: http://tools.cairns.com.au/photo_gallery/photo_gallery_popup.php?category_id=3825

Here's a different one, also cool.

(http://x87.xanga.com/30dd520652531120054791/z86400719.jpg)

Somebody hold me.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 23 Oct 2008, 19:16
Holy shit, that it fuckin' creepy...
Sorry, I don't actually have anything to add, I just really needed to put that out there.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 23 Oct 2008, 19:17
Christ. I am so glad we don't have spiders like that here.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 23 Oct 2008, 19:19
Ok hey to lighten the mood a little I also found this:

(http://invasiveinfection.files.wordpress.com/2008/03/health_bar_spider.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tommydski on 23 Oct 2008, 19:23
Oh shit, maybe I don't want to go to Australia so badly any more.

Someone please remove either our forumites or all the improbably huge spiders from that obviously blighted land at once.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 23 Oct 2008, 20:25
[img width= height=]http://upload.wikimedia.org/wikipedia/en/8/8a/AdvertYoungsTheHatterVictorianEraBridgeportCT.jpg[/img]
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 23 Oct 2008, 20:40
Forget the spiders. That is frightening.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 24 Oct 2008, 02:49
http://www.youtube.com/watch?v=Kum5-wkqMZ4
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 24 Oct 2008, 11:17
(http://img227.imageshack.us/img227/6899/chairsqt6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 24 Oct 2008, 11:22
The one chair with the missing back completely ruins it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 24 Oct 2008, 11:30
I am trying to figure out what this is for.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 24 Oct 2008, 11:43
What is that? A school of trees? I thought only fish did that? I don't understand...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 24 Oct 2008, 11:47
I'm pretty sure the point is the way they're set on the trees. It's kind of like one of those locking ring puzzles, except the one backless chair makes it painfully obvious how it's done. As I said, it kind of ruins the picture.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: maxusy3k on 24 Oct 2008, 11:48
See I thought that was obvious but now that people are like "Wait what is going on here?" I am all trying to analyse it and figure out if I'm missing something.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 24 Oct 2008, 12:15
Yeah. I was looking for a joke in that picture.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 24 Oct 2008, 12:26
I was thinking this was so the tree-huggers could better express their love, without their legs getting tired.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 24 Oct 2008, 12:28
I was thinking it was so the trees could sit down.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 24 Oct 2008, 15:16
I was hoping that was merely trying to trick the responder into finding a point when in essence it is entirely random.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 24 Oct 2008, 16:11
There's no joke that I'm aware of.  It's just a picture.  A pointless picture in the pointless thread.

My first thought was that all the trees with chairs seemed to be about the same age, so someone had a bunch of old chairs and they went out into the woods and placed them over a bunch of young trees.  Then they came back 20 years later to take a picture that would make people wonder how they did it.  But that seems like a lot of effort for a simple wtf.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 24 Oct 2008, 16:16
But it's an installation; it's art.

(Philistines...)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 24 Oct 2008, 16:28
Less talky, more random art...y

(http://img115.imageshack.us/img115/7840/dancingghostgc2.gif)

(http://img404.imageshack.us/img404/2900/jackpumpkinkl3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 24 Oct 2008, 16:38
IBM did some odd things when advertising OS/2:

(http://www.os2docs.org/as/w4/images/AS_Art01T.jpg)   (http://www.gifs.net/Animation11/Animals/Elephants/Dancing_elephant_2.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cernunnos on 24 Oct 2008, 20:25
http://www.youtube.com/watch?v=DpIvJrtQktQ
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 25 Oct 2008, 08:24
Funny little CGI short (http://www.vimeo.com/1084537)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 25 Oct 2008, 09:15
I remember when I first saw that movie thinking how odd it was for the writers to make the put-upon main character ginormous, while the harassing antagonists are tiny. It's hard to see a character as the underdog to root for when they're several times as large as any of the other characters. Instead it just feels like the main character is bullying the little guys.

Ultimately, the writing is only so-so because the point of that movie was to show off Blender. That is, the movie was made as a big ole tech demo to prove that an open-source tool can be used to make feature film quality animation.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 25 Oct 2008, 09:49
C'mon, you've never heard the term "gentle giant"?  He almost cried when the fox ripped off the butterfly wings! 

Besides, I just put it up because it made me laugh, I don't care how good or bad it is, that's a discussion for the Movies board.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 25 Oct 2008, 13:32
http://www.smh.com.au/interactive/2008/world/us-election-plastic-pollies/index.html

Claymation McCain, Palin and Obama.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 25 Oct 2008, 22:23
I don't know if it's my computer, but the talking doesn't sync up with the claymation


Also, since it was posted as the final post last page I don't think many people took the time to see it
(http://img404.imageshack.us/img404/2900/jackpumpkinkl3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 25 Oct 2008, 22:29
It doesn't sync with mine either. doesn't help that the animation is not that good.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 25 Oct 2008, 22:44
The Residents - Benny the Bouncing Bump (http://www.youtube.com/watch?v=y3Ei8q8kKYA)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 26 Oct 2008, 10:13
Hula Hoops have never been so awesome (http://www.spikedhumor.com/Article.aspx?id=166832)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 26 Oct 2008, 11:28
See, people need start doing that in sync.

I would watch that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 26 Oct 2008, 12:26
Man, that ain't nothing ... it needs to be ON FIRE. (http://www.metacafe.com/watch/1114736/fire_gypsy_fire_hooping/)

And then they need to be on stilts. (http://www.youtube.com/watch?v=xkgFl60mas4)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 26 Oct 2008, 14:31
One of my life goals is to go to Burning Man.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 26 Oct 2008, 14:46
One of my life goals is to go to Burning Man.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 27 Oct 2008, 08:32
One of my life goals is to burn a man.

Nah, I'm just kidding. Its not that fun.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eli on 27 Oct 2008, 08:54
(http://i6.photobucket.com/albums/y250/Dogbert32/custom_1224792731820_pharrellchair2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 27 Oct 2008, 10:19
-Awesome Nightmare Before Christmas Pumpkin Carving-

Okay, next year, I am buying some pumpkins and carving tools to try this form of pumpkin carving. I mean, this whole "shaving" and"gouging" technique thing looks waaaaaaaaay cooler then your regular, every day "carving". --I found some really cool websites the other night when i was looking for patterns for my carving the other night. I'll have to find a link later.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: fozmo on 27 Oct 2008, 14:26
oh hell, that was a pumpkin carving? Shows how observant I am.

Anyway, 4chan creeps me out. SFW (http://img528.imageshack.us/my.php?image=hellisotherchannersbb5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 27 Oct 2008, 15:04
Dear god
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 27 Oct 2008, 15:24
looks legit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 27 Oct 2008, 18:20
Okay, I've gotta toss an aside to the murderers on 4chan; people've gotta sleep tonight... Enjoy this Alice in Wonderland (http://www.youtube.com/watch?v=pAwR6w2TgxY) clip. If you're on drugs, even better.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 27 Oct 2008, 18:29
hey that was really good! I'd buy his album if he recorded one.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 27 Oct 2008, 18:40
Quote from: youtube
i would bang the f*** out of alice


Keep your fantasies to yourself people.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: vegkitkat on 27 Oct 2008, 18:47
I wish I could dance this well.

http://ca.youtube.com/watch?v=qqXi8WmQ_WM
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 27 Oct 2008, 21:46
YEAH! YOU BUILD THAT FUCKIN' DRIVEWAY! (http://www.youtube.com/watch?v=7593rbqRMz4)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 27 Oct 2008, 21:48
(http://img530.imageshack.us/img530/2395/legendofbarackobamaov9.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 27 Oct 2008, 22:39
Barack Obama was raised in a log cabin that he built with his bear hands.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 27 Oct 2008, 22:43
I took this the other day in Sydney.

(http://img.photobucket.com/albums/v371/est_xplosif/qc/FRATHOUSE.jpg)

I wish this were photoshopped.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 27 Oct 2008, 22:48
 I kind of want to imitate those drive-by insult guys, but with insults that don't make any sense at all.

 "HEY GET BACK TO THE STORE YOU FUCKING BAG OF CHEETOS!"

 Also, that Alice song is beautiful!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 27 Oct 2008, 22:51
Hey est, where is that 'cause I've never ever seen that before in Sydney.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 28 Oct 2008, 04:15
(http://img.photobucket.com/albums/v663/Lapuz/jizz.jpg)

Another unphotoshopped photo of a store in Sydney.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 28 Oct 2008, 05:36
DURRRRR
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 28 Oct 2008, 06:57
:sigh: Australians.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cam on 28 Oct 2008, 08:04
Pie! (http://www.youtube.com/watch?v=JZOxqVl5oP4)

Save your self some time and don't read the comments on the video
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 28 Oct 2008, 08:56
Save your self some time and don't read the comments on the video

This advice applies to most YouTube videos.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 28 Oct 2008, 10:08
I found this on campus the other day:

(http://www.pretentiousgamer.com/badwolf.jpg)

And this in a random general store place a couple of weeks back:

(http://www.pretentiousgamer.com/hotdawg.jpg)
(http://www.pretentiousgamer.com/whut.jpg)
(http://www.pretentiousgamer.com/ohgod.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 28 Oct 2008, 10:58
It's a Happy Hot Dog Toaster!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 28 Oct 2008, 12:11
haha my dad actually got one of those as a gag gift last Christmas. It may or may not still be at our house.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 28 Oct 2008, 12:16
Man, fuck you guys, I would totally own one of those. That thing is awesome!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 28 Oct 2008, 12:53
heck yeah man, have you ever tried toasting hot dog buns in a regular toaster? Wait... have you ever tried toasting a hot dog bun at all?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 28 Oct 2008, 12:55
Oddly enough, for lunch today I used my toaster oven to make me a hot dog. I could've saved a lot of time and frustration with this device.

And by a lot, I mean none. Not even a little.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Metope on 28 Oct 2008, 12:57
But it smiles at you while you're making it! That's gotta count for something, right?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Noct on 28 Oct 2008, 13:20
It's all fun and games until hot dogs start flying out of your eyes.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 28 Oct 2008, 13:28
Pie! (http://www.youtube.com/watch?v=JZOxqVl5oP4)

Save your self some time and don't read the comments on the video


(for those of you who did read the comments)

FACT: If you put the word "FACT" in front of a sentence, it automatically makes it true.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 28 Oct 2008, 13:40
hahaha.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 28 Oct 2008, 13:57
Also, I don't know if any of these have been posted before, but shit, it's fucking hilarious.

McCain's Brain (http://www.youtube.com/watch?v=7sGjAWSUCNQ)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 28 Oct 2008, 14:25
I want whatever these are. (http://www.youtube.com/watch?v=17ojj7tgrqw)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 28 Oct 2008, 14:58
That's a hang.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 28 Oct 2008, 15:17
Hey est, where is that 'cause I've never ever seen that before in Sydney.

It's on Pitt St, right near Centrepoint.  It is full of American douchebag fashion and is awful.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 28 Oct 2008, 15:21
This was cute.

(http://i37.tinypic.com/2r57xvn.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 28 Oct 2008, 15:36
Seriously, Obama is becoming the new Chuck Norris, and i have the heavy feeling that it can't last. Eventually he's going to be president and we'll all realize he's human and be seriously disappointed.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 28 Oct 2008, 16:12
Yeah, I think some people are going to be massively disappointed with Obama when he gets in and isn't the second coming of the Lord.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 28 Oct 2008, 16:22
Pfft he's not the second coming of the Lord. Jesus was the first coming of The Obama.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 28 Oct 2008, 16:53
is C.h.u.c.k. n.o.r.r.i.s. on the language filter or are you messing with my posts, Est?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 28 Oct 2008, 16:59
It's been a word filter for ages, like nigger, butternut, +1 and some others I can't remember.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 28 Oct 2008, 17:27
which weren't filtered just then?

How'd you do that?

Witch!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: johnny5 on 28 Oct 2008, 17:30
this is incredibly not safe for work...or in public. in fact i'm putting it in code so you dont accidentally click it. but it's the funniest thing i've ever seen/heard

yes.
Code: [Select]
http://www.cakefarts.com/
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 28 Oct 2008, 17:39
Butternut?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 28 Oct 2008, 17:41
Maybe it was butternut squash. I know it used to change to "fuck squash", maybe it's been taken off?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 28 Oct 2008, 18:09
Don't go to cakefarts, it's just fucking dumb.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liam on 28 Oct 2008, 21:43
(http://liam.leveluphost.com/partytime.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 28 Oct 2008, 21:56
(http://img401.imageshack.us/img401/5003/nakedghostriderow5.jpg)

(http://img291.imageshack.us/img291/5499/simpsonsinvadersya1.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: IronOxide on 28 Oct 2008, 21:59
Maybe it was butternut squash. I know it used to change to "fuck squash", maybe it's been taken off?

Well, originally, it was fuck filtered to butternuts, and then after some protest, butternut became fuck, and fuck was reverted. In the end it is back to normal.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: allison on 28 Oct 2008, 22:28
http://www.236.com/video/2008/watch_synchronized_presidentia_9857.php (http://www.236.com/video/2008/watch_synchronized_presidentia_9857.php)

they were all the same debate
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 29 Oct 2008, 06:21
http://www.palinaspresident.us/ (http://www.palinaspresident.us/)

also that debate thing  :-D wow
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 29 Oct 2008, 06:44
<IMG of nude Ghost Rider>
That is hilarious. Thanks for that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 29 Oct 2008, 07:53
Why are the bottle and glasses melted on the side farthest away from him, though? This bothers me.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 29 Oct 2008, 08:06
Maybe he was wearing those glasses while putting on that tanning lotion? I'd imagine if your body is a construct of bone and fire, though, the last thing you'd want is a tan. I'd imagine a bleaching agent would be better.

Imagine that scene, with the fleeing criminal "Oh God! It's Ghost Rider! This is the worst day ever! And why does his skull have a tan!?! That's just all too wrong! I'm horrified and confused!"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jed on 29 Oct 2008, 13:18
(http://ihasahotdog.files.wordpress.com/2008/10/funny-dog-pictures-the-pain.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 29 Oct 2008, 16:36
(http://fc22.deviantart.com/fs17/f/2007/214/e/f/Savage_Pikachu_by_Nocturnal_Devil.jpg)

from this dude http://nocturnal-devil.deviantart.com/ (http://nocturnal-devil.deviantart.com/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 29 Oct 2008, 23:51
(http://farm4.static.flickr.com/3158/2982504436_5b3a8dff93_o.jpg)

(http://farm3.static.flickr.com/2127/2959000409_d2ff32c0f2_o.jpg)

(http://farm4.static.flickr.com/3181/2959841402_15ac9f0d00_o.jpg)

(http://farm4.static.flickr.com/3285/2959841148_3bd4e80a26_o.jpg)

WTF BROCCOLI
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: bbqrocks on 30 Oct 2008, 00:00
I love the fact that I discovered 'red meat' through this thread. Thanks guys!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 30 Oct 2008, 00:08
(http://img511.imageshack.us/img511/615/20080509iphhonekq5kr2.jpg) (http://www.playmedesign.com/2008/05/ifuture.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CamusCanDo on 30 Oct 2008, 00:22
WTF BROCCOLI

SOYLENT GREEN IS PEOPLE
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 30 Oct 2008, 04:03


(http://www.poundart.com/art/randcomix/randcomix_1993-12-21.gif)

(http://www.lesjones.com/www/images/posts/villagepe645564ople.jpg) <--- where did we go wrong?

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 30 Oct 2008, 19:36
(http://img390.imageshack.us/img390/9250/seemtobeonfirecd0.jpg)

(http://img399.imageshack.us/img399/4712/venusaurza6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 30 Oct 2008, 21:20
(http://avatarsofvengeance.com/images/hadoken.gif)

(http://d11885738.u33.surftown.nu/images/swedish-dance-bands-033.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 30 Oct 2008, 23:04
I'm pretty sure I need this game now. (http://www.n4g.com/pc/News-224231.aspx)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 30 Oct 2008, 23:27
(http://farm4.static.flickr.com/3226/2973101192_ea763ba194.jpg)

(http://farm4.static.flickr.com/3188/2945623741_cf6eb90f86_o.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 31 Oct 2008, 01:23
Some people collect stamps, some collect shot glasses and some collect train numbers...

I've decided I want to collect those little black-and-white animated manga-style gifs.

Y'know, because of teh AWESOME!!!

(The Ninja Bunny one's the best, BTW)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 31 Oct 2008, 04:10
I'm pretty sure I need this game now. (http://www.n4g.com/pc/News-224231.aspx)

oh wauw.

I need a PS3 and a copy of this game and I will be good until the election.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 31 Oct 2008, 04:38
you mean... for the next 5 days?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 31 Oct 2008, 06:11
I do not have a very long attention span when it comes to computer games.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 31 Oct 2008, 07:27
(http://www.scaaary.com/files/picture/09856462.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 31 Oct 2008, 07:30
Nasty Demons are the best kind!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 31 Oct 2008, 09:42
So watch out this Hallow-
een not to open doors to very nasty demons.

"No, Grandma... you are the demons."
And then she was a zombie.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 31 Oct 2008, 09:48
"No, Grandma... you are the demons."
And then she was a zombie.

Yes.
Yes.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 31 Oct 2008, 18:45
(http://leadpaintcomics.com/comics/2008-09-15-night.jpg)

STORY OF MY FUCKING LIFE.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Misereatur on 01 Nov 2008, 12:05
http://www.liveleak.com/view?i=724_1225139182
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 01 Nov 2008, 15:03
(http://img.photobucket.com/albums/v289/0bsessions/Random%20Forum%20Junk/fury_campaign_poster.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 02 Nov 2008, 02:13
(http://memeparty.com/i/477be124096f8eecbd6b2f1d82767567.jpg)

(http://memeparty.com/i/f00913e58d9e7d93f769f4f41b667413.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 02 Nov 2008, 05:11
Obsessions: How about Nick Fury/Frank Castle?

I should think the mere sight of the poster would make Republicans pass out from sheer delight.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 02 Nov 2008, 07:40
STORY OF MY FUCKING LIFE.

Mine's more like "Oh hmmm i guess I'll just check my emails and then I'll get to work oh hey something I'm watching oin eBay ends soon yesss Achewood updated hey I wonder what's going on in the fashion thread EIGHT HOURS LATER
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 02 Nov 2008, 09:52
(http://www.halolz.com/wp-content/uploads/2008/11/haloween-samus.jpg)

I wonder how many tries it took.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 02 Nov 2008, 13:19
(http://i28.photobucket.com/albums/c213/hey_there_fatty/TeodorsInsaneNewDanceMove.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 02 Nov 2008, 13:27
OMG someone finally made a GIF of that.  Awesome!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 03 Nov 2008, 05:34
This thread need more of these
(http://upload.wikimedia.org/wikipedia/commons/d/d0/Shuttlecocks_Yonex_Aerosensa_20.jpg)

shuttlecocks
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 03 Nov 2008, 05:46
I could have sworn those looked like birdies. Maybe that's just me.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 03 Nov 2008, 06:07
Yeah I've always heard 'em called Birdies.

But, you know, shuttlecocks works. I suppose.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 03 Nov 2008, 06:29
Birdies? Who the heck calls them birdies?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 03 Nov 2008, 06:34
People who are not heathens.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 03 Nov 2008, 07:19
Maybe they were called that cause its better to hit them than the real thing  :lol:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 03 Nov 2008, 08:04
(http://remiq.net/static/img/remiq.net_9530.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 03 Nov 2008, 08:40
I will never be able to look at a subway napkin without seeing dancing tomatoes ever again. This is a good thing.

Not that I look at subway napkins very often.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 03 Nov 2008, 09:49
That is the exact same sentiment that ran through my mind when I saw that...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 03 Nov 2008, 10:16
That is epic,nice artwork =D
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 03 Nov 2008, 10:29
I wish I could take credit for it, but I only found it with StumbleUpon. It made me giggle so much.

TOMATO NIGHTCLUB
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 03 Nov 2008, 12:39
adinfinitum on obama (http://adinfinitum.livejournal.com/235775.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 03 Nov 2008, 14:00
I think she likes him.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 03 Nov 2008, 15:15
(http://91.121.132.199/gifs/7191.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 03 Nov 2008, 15:30
I know this happens way too often, but I couldn't help myself:

(http://photography.nationalgeographic.com/staticfiles/NGS/Shared/StaticFiles/Photography/Images/POD/s/sea-lion-australia-703813-sw.jpg)

@vendetagainst

She does doesn't she? Although I did definitely laugh at some of the pictures there.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CardinalFang on 03 Nov 2008, 16:58
(http://img.photobucket.com/albums/v620/theweaselking/Thirdmain/pizzarolls.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 04 Nov 2008, 08:30
I gotta find where these pulp novel shoops come from.
They are rad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 04 Nov 2008, 16:39
O.o.....uhhh yeah my mind is blown.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 04 Nov 2008, 16:41
I've been seeing that a lot recently

(http://img206.imageshack.us/img206/4515/rorsachfunju4.gif)

(http://i493.photobucket.com/albums/rr300/ganons/mccain.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ganonsdoom on 04 Nov 2008, 17:00
I've been seeing that a lot recently

(http://img206.imageshack.us/img206/4515/rorsachfunju4.gif)

(http://i493.photobucket.com/albums/rr300/ganons/mccain.jpg)

I take pride in my work :D
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 04 Nov 2008, 19:25
sure is a good thing you quoted those pictures
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 04 Nov 2008, 23:06
I've been seeing that a lot recently

(http://img206.imageshack.us/img206/4515/rorsachfunju4.gif)

(http://i493.photobucket.com/albums/rr300/ganons/mccain.jpg)

I take pride in my work :D

sure is a good thing you quoted those pictures


i agree
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 05 Nov 2008, 12:46
(http://forbiddenplanet.co.uk/blog/wp-content/uploads/2008/06/hulk%20vs%20spidey.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ViolentDove on 06 Nov 2008, 18:01
Don't know if this has been posted here yet (I'm guessing it's doing the usual internet rounds), but it's pretty amusing!

(http://i229.photobucket.com/albums/ee166/kasperfl1p/1223222171255.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 06 Nov 2008, 19:16
(http://www.phun.org/newspics/funny_friday/3114.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 06 Nov 2008, 19:49
(http://img.photobucket.com/albums/v374/Seseilia/DOABARRELROLL.gif)

(http://img.photobucket.com/albums/v374/Seseilia/pwnage.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 06 Nov 2008, 21:00
OH CHRIST SO CUTE (http://vimeo.com/1061385)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 06 Nov 2008, 21:41
(http://img152.imageshack.us/img152/4483/jawsoflifesw0.jpg)

(http://img152.imageshack.us/img152/1729/cutemonsterlo8.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 07 Nov 2008, 03:42
President Richard Pryor (http://au.youtube.com/watch?v=EtlDVi_1JMg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 07 Nov 2008, 04:52
I expected that to be funnier. I actually bookmarked it solely based on it's title, and then afterward deleted the bookmark because it wasn't really that good.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 07 Nov 2008, 04:57
Man what. Did you watch it all the way through?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 07 Nov 2008, 08:42
For some reason, I love the one with the little kid trying to throw the cat into the pool. 

That the cat escapes and the kid falls in seems somehow right to me.  Maybe it's 'cause I like cats and don't like little kids.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 07 Nov 2008, 08:52
All that cat throwing in thing makes me wonder is why is that adult standing behind the little kid not stopping the little kid from throwing the cat in the pool.

That kid deserves it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thaes on 07 Nov 2008, 08:55
That is not a way to carry a cat!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 07 Nov 2008, 09:14
That the cat escapes and the kid falls in seems somehow right to me. 

That's a perfectly human response whether you like kids or not. If anything deserves a "For great justice!" caption, it's that thing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 07 Nov 2008, 11:51
That poor dog! I foresee barf on that carpet.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: TheFuriousWombat on 07 Nov 2008, 14:00
Two things:
1. Oh man that Richard Pryor thing is just so bad. Seriously. It's really, really bad.
2. I watched that kid falling in the pool gif about a dozen times and kept laughing. That's one awesome cat!
Title: RL Photoshop
Post by: jhocking on 08 Nov 2008, 07:20
I am posting this here because I don't know if it should go in the Computers forum or the Art forum.  Anyway, it's Photoshop's interface done in real life!

http://gizmodo.com/5080163/what-photoshop-would-look-like-in-real-life
Title: Re: RL Photoshop
Post by: imapiratearg on 08 Nov 2008, 07:39
That's pretty awesome!  It does the real UI justice, I'd say.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scarychips on 08 Nov 2008, 20:17
(http://www.smbc-comics.com/comics/20020916-2.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 08 Nov 2008, 20:46
Oh god that was a great post.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 08 Nov 2008, 20:48
FUCK YEAH SHARKS
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 08 Nov 2008, 21:19
(http://img.photobucket.com/albums/v12/sademie/01.jpg)
(http://img.photobucket.com/albums/v12/sademie/02.jpg)
(http://img.photobucket.com/albums/v12/sademie/03.jpg)
(http://img.photobucket.com/albums/v12/sademie/04.jpg)
(http://img.photobucket.com/albums/v12/sademie/05.jpg)
(http://img.photobucket.com/albums/v12/sademie/06.jpg)
(http://img.photobucket.com/albums/v12/sademie/07.jpg)
(http://img.photobucket.com/albums/v12/sademie/08.jpg)
(http://img.photobucket.com/albums/v12/sademie/09.jpg)
(http://img.photobucket.com/albums/v12/sademie/10.jpg)
(http://img.photobucket.com/albums/v12/sademie/11.jpg)
(http://img.photobucket.com/albums/v12/sademie/12.jpg)
(http://img.photobucket.com/albums/v12/sademie/13.jpg)
(http://img.photobucket.com/albums/v12/sademie/14.jpg)
(http://img.photobucket.com/albums/v12/sademie/15.jpg)
(http://img.photobucket.com/albums/v12/sademie/16.jpg)
(http://img.photobucket.com/albums/v12/sademie/17.jpg)
(http://img.photobucket.com/albums/v12/sademie/18.jpg)
(http://img.photobucket.com/albums/v12/sademie/19.jpg)
(http://img.photobucket.com/albums/v12/sademie/20.jpg)
(http://img.photobucket.com/albums/v12/sademie/21.jpg)
(http://img.photobucket.com/albums/v12/sademie/22.jpg)
(http://img.photobucket.com/albums/v12/sademie/23.jpg)
(http://img.photobucket.com/albums/v12/sademie/24.jpg)
(http://img.photobucket.com/albums/v12/sademie/25.jpg)
(http://img.photobucket.com/albums/v12/sademie/26.jpg)
(http://img.photobucket.com/albums/v12/sademie/27.jpg)
(http://img.photobucket.com/albums/v12/sademie/29.jpg)
(http://img.photobucket.com/albums/v12/sademie/30.jpg)
(http://img.photobucket.com/albums/v12/sademie/31.jpg)
(http://img.photobucket.com/albums/v12/sademie/32.jpg)
(http://img.photobucket.com/albums/v12/sademie/33.jpg)
(http://img.photobucket.com/albums/v12/sademie/34.jpg)
(http://img.photobucket.com/albums/v12/sademie/35.jpg)
(http://img.photobucket.com/albums/v12/sademie/36.jpg)
(http://img.photobucket.com/albums/v12/sademie/37.jpg)
(http://img.photobucket.com/albums/v12/sademie/38.jpg)
(http://img.photobucket.com/albums/v12/sademie/39.jpg)
(http://img.photobucket.com/albums/v12/sademie/40.jpg)
(http://img.photobucket.com/albums/v12/sademie/41.jpg)
(http://img.photobucket.com/albums/v12/sademie/42.jpg)
(http://img.photobucket.com/albums/v12/sademie/43.jpg)
(http://img.photobucket.com/albums/v12/sademie/44.jpg)
(http://img.photobucket.com/albums/v12/sademie/45.jpg)
(http://img.photobucket.com/albums/v12/sademie/46.jpg)
(http://img.photobucket.com/albums/v12/sademie/47.jpg)
(http://img.photobucket.com/albums/v12/sademie/48.jpg)
(http://img.photobucket.com/albums/v12/sademie/49.jpg)
(http://img.photobucket.com/albums/v12/sademie/50.jpg)
(http://img.photobucket.com/albums/v12/sademie/51.jpg)
(http://img.photobucket.com/albums/v12/sademie/52.jpg)
(http://img.photobucket.com/albums/v12/sademie/53.jpg)
(http://img.photobucket.com/albums/v12/sademie/54.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 08 Nov 2008, 21:27
Holy shit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 08 Nov 2008, 21:38
I want my fifteen minutes back.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CamusCanDo on 08 Nov 2008, 22:09
Man, I don't. Those were fun!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 08 Nov 2008, 23:06
I would ask if it would've been easier to just show one and link to the damn webpage, but that would be like asking a deaf man who is favorite band is.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 08 Nov 2008, 23:20
Fun? sure why not,SWAT 3 is more fun,but hey those were well spent mins.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 09 Nov 2008, 01:15
I would ask if it would've been easier to just show one and link to the damn webpage, but that would be like asking a deaf man who is favorite band is.

I didn't have a link to give :(
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dazed on 09 Nov 2008, 06:51
Did that post break the thread for anyone else?  :?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 09 Nov 2008, 08:41
I would ask if it would've been easier to just show one and link to the damn webpage, but that would be like asking a deaf man who is favorite band is.

I didn't have a link to give :(
http://www.legorobotcomics.com?  That's where they all are...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 09 Nov 2008, 10:50
AAAAA

AAAA

WHAT AM I

WHO ARE YOU

I'M FUCKING MY HAND

AAAAAAAAAA

JUMP

WHAT IS THIS (http://www.youtube.com/watch?v=l_8yPap-k_s)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 09 Nov 2008, 11:30
I want my fifteen minutes back.

am i the only person who gets kind of annoyed when people say this? be honest with yourself, you're on the internet. you weren't going to do anything useful with those fifteen minutes anyway.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 09 Nov 2008, 14:05
I agree, really. If those minutes were that important  to you, you could have bunged some pop-tarts in the toaster or something, made it worth your while.
Also, did you really need fifteen of them? Maybe I am just a dirty scan-reader, I suppose, and I didn't digest the information properly, but I think (in this case) not much digestion was required.


(edit) POP-TARTS!
(http://farm3.static.flickr.com/2136/2226796016_7ea92cd843.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 09 Nov 2008, 14:33
man, those things are disgusting
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 09 Nov 2008, 14:54
http://www.youtube.com/watch?v=T0Y5-HX2-78 (http://www.youtube.com/watch?v=T0Y5-HX2-78)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: TheFuriousWombat on 09 Nov 2008, 15:51
What the hell kind of pop tarts are those? The pastry actually looks good.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 09 Nov 2008, 18:25
(http://i.somethingawful.com/inserts/articlepics/photoshop/10-03-08-oneletter/Fors-Yard.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 09 Nov 2008, 20:15
I want my fifteen minutes back.

am i the only person who gets kind of annoyed when people say this?
Yes.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 09 Nov 2008, 21:23
No.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 09 Nov 2008, 21:25
No.


 :-)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 09 Nov 2008, 21:31
Also, I didn't see the Richard Pryor thing until now and I don't really get why people are disappointed in it.  There were a handful of laugh-out-loud funny bits in it, like when they start talking animatedly about the black coach getting the shaft  and then the guy from the Mississippi Herald stands up and Pryor's looking at him all irate and tells him to sit down, and when the guy near the end starts talking about his mother and people go apeshit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 09 Nov 2008, 22:21
No.


 :-)
Maybe?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 09 Nov 2008, 22:27
(http://img395.imageshack.us/img395/9167/shibainune0.jpg)

(http://img395.imageshack.us/img395/7792/stewug6.jpg)

Norman Osborn is fucking crazy (http://img395.imageshack.us/img395/9207/normanosbornisacrazyfucjh8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 10 Nov 2008, 12:35
I think that dog one is a photoshop, dogs don't have the flexibility to do that

(http://dummcomics.com/images/comics/kimbo/1930_elections_v2.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 10 Nov 2008, 17:37
Ricky Garduno is pretty funny.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 10 Nov 2008, 18:03
My god thats funny as hell!

whoever made that needs a hug big time that kicks ass
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 10 Nov 2008, 19:28
YOU MUST USE THE FORCE (http://uk.youtube.com/watch?v=lk5_OSsawz4)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 10 Nov 2008, 19:37
(http://img379.imageshack.us/img379/5007/512chinaao9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 10 Nov 2008, 20:30
What
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 10 Nov 2008, 20:39
i am sad
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CamusCanDo on 10 Nov 2008, 21:18
This is pointless thread, not sad/depressed thread.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 10 Nov 2008, 21:38
I don't know why, but these (http://periodicvideos.com/#) interest me a lot.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 10 Nov 2008, 21:43
It was sad,but it also gave me hope,that one death might let many live  :-)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 10 Nov 2008, 22:08

kisscopy and paste
RULES!!! !``if you think
kiss rules
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 10 Nov 2008, 22:26
from youtube comments:

I went to the doctors office. There was a black guy sitting in a chair, taking a nap. His dick was hanging out. He had a big black dick. His dick was snoring. It was a big mean black dick, huge, big, enormous.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 10 Nov 2008, 22:55
Why do people always have to cock up this thread with horrible shit
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 11 Nov 2008, 00:39
I don't understand what you mean
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 11 Nov 2008, 01:06
yeah fuck your penis

(http://apina.nwpshost.com/10406.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 11 Nov 2008, 01:36
what.

my soul.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 11 Nov 2008, 01:58
So awesome
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 11 Nov 2008, 05:25
Best thing in here in a while
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 11 Nov 2008, 07:33
(http://mail2.someecards.com/filestorage/thi_99.jpg)

www.someecards.com (http://www.someecards.com)

There's some good ones there.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 11 Nov 2008, 09:51
YOU MUST USE THE FORCE (http://uk.youtube.com/watch?v=lk5_OSsawz4)

This wins everything of all time.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 11 Nov 2008, 13:39
Haha thats awesome oh yeah are you crying? :lol:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 11 Nov 2008, 15:01
(http://www2.b3ta.com/host/creative/49722/1225847832/dailymailfrontpage.jpg)



Also http://uk.youtube.com/watch?v=Hq5_joo5l5I
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 11 Nov 2008, 17:54
So goddamn adorable? (http://www.collegehumor.com/video:1890164)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 11 Nov 2008, 18:02
OH CHRIST SO CUTE (http://vimeo.com/1061385)

It is now in the thread twice BUT THAT'S OKAY BECAUSE AUGH SO CUTE
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: abadname on 11 Nov 2008, 18:34
http://cdn1.ustream.tv/swf/4/viewer.45.swf?cid=317016

Cutest dogs.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 11 Nov 2008, 18:50
I have been watching this all day. It is hilarious and depressing at various intervals.

You see the hat?! (http://www.youtube.com/watch?v=qbrsZN40sJU)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 11 Nov 2008, 19:38
(http://img371.imageshack.us/img371/3452/capejq5.jpg)

(http://img371.imageshack.us/img371/7761/jokexo0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 11 Nov 2008, 20:16
(http://mensa-barbie.com/bloggerimages/Veterans_day_ambrose_86yo_VET) (http://www.youtube.com/watch?v=GPFjToKuZQM)


click picture for today's song.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 11 Nov 2008, 20:33
I am quite amazed people from WWI are still alive. If I'm not mistaken it's been 100 years since the end.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liam on 11 Nov 2008, 20:48
(http://liam.leveluphost.com/silly/naughtydanrad.gif)
(http://liam.leveluphost.com/silly/2niqkbs.jpg.gif)

Observe, as I kill my own bandwidth!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 11 Nov 2008, 21:29
I am quite amazed people from WWI are still alive. If I'm not mistaken it's been 100 years since the end.

it's a world war two vet from britain. they didn't update their helmet until near the very end. the song is world war one, picture is ww2
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 11 Nov 2008, 21:49
I am quite amazed people from WWI are still alive. If I'm not mistaken it's been 100 years since the end.

90, actually
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 11 Nov 2008, 23:43
(http://yzoz.com/images/tarsiers.jpg)

(http://img224.imageshack.us/img224/3962/142wp.jpg)

(http://img201.echo.cx/img201/2766/booga3ss.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 12 Nov 2008, 05:27
Daily Mail front page

If only this was completly beyond what Daily Mail readers actually think.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tommydski on 12 Nov 2008, 05:43
The actual content of the Daily Mail is way, way more offensive than that shopped headline.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 12 Nov 2008, 06:08
Then it must be fucking off the scale, 'cause I found that whole thing incredibly offensive.  I wasn't aware that "racist humor" even existed on such a large scale, and is apparently acceptable, but I guess I'm naive that way.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 12 Nov 2008, 06:33
Hey, it's a joke ; specifically at the expense of people who might think that way.  That's not racism - it's debunking racism.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Oli on 12 Nov 2008, 07:38
The best bit is the DVD.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 12 Nov 2008, 08:09
Oh, it's a joke.  Now I get it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 12 Nov 2008, 08:15
(http://www.georgehernandez.com/h/aaBlog/2005/media/03-08_SpiderManBibleStories.jpg)
(http://www.portlandmercury.com/imager/spider_mans_greatest_bible_stories_/b/original/26782/ef90/feature-5247.jpeg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 12 Nov 2008, 08:18
Oh, it's a joke.  Now I get it.

http://en.wikipedia.org/wiki/Satire
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 12 Nov 2008, 10:31
Oh for fuck's sake, I know what satire is.  I find most satire pretty funny; it's my favorite form of humor. 

But the key to satire is that you understand the subject and it's pretty obvious that what you're seeing is not serious, even if it's being presented that way.  Spouting n-words and going on about Obama can just as easily be serious; there are people who think that way. But as soon as someone calls them on it, they say "Lighten up, it's a joke."  Because that makes it alright.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wolf on 12 Nov 2008, 11:18
Pretty sure these are being bred to replace the dog as your family pet. I'll take one please.

(http://seattlepi.nwsource.com/dayart/20081112/62183592890_10.jpg)
(http://seattlepi.nwsource.com/dayart/20081112/45083592897_10.jpg)

pygmy hipppo's
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 12 Nov 2008, 11:25
O. M. G. If they would survive a Wisconsin winter, I would -totally- take a Pygmy Hippo as a pet. So cute!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 12 Nov 2008, 11:42
that thing scares me  :-( dont know why though
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Yakob on 12 Nov 2008, 12:33
 Finally! (http://www.youtube.com/watch?v=NBfi8OEz0rA)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 12 Nov 2008, 13:17
Ok wow just wow
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 12 Nov 2008, 19:07
The Pygmy Hippo video is better (http://au.youtube.com/watch?v=itPDKIebAos). LOOK AT IT WIGGLE IT'S EARS OMG
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Bowers on 12 Nov 2008, 19:57
that video is the best thing ever to watch by stoned



the ears guys...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 12 Nov 2008, 20:10
You need to watch more stuff stoned, man.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 12 Nov 2008, 20:59
Oh god, it sounded like the little thing was purring. the next step is toy hippos, then they'd be just a accessible as pets that pigmy-pot bellies are.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 12 Nov 2008, 21:04
(http://fc93.deviantart.com/fs19/f/2007/227/1/1/Best_Friends_by_spacecoyote.jpg)

The days are just packed.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 12 Nov 2008, 21:09
That picture can only lead us down a bad road.



(http://img90.imageshack.us/img90/8223/falconpunchso0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 12 Nov 2008, 21:21
That picture can only lead us down a bad road.

It's not the picture that's bad man, it's your brain. That's just a drawing of a kid and his tiger.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 12 Nov 2008, 21:47
YOU'VE BEEN THERE, YOU KNOW WHAT WILL HAPPEN
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 12 Nov 2008, 22:18
OhgodpleasenomoreCalvinandHobbesslash.com
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 12 Nov 2008, 22:50
http://community.livejournal.com/calvinxhobbes/

???
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 12 Nov 2008, 22:55
(http://img.photobucket.com/albums/v663/Lapuz/random/calhobbes.jpg)

I found some better pics, but they had dongs in them. This was the best I could do on short notice!


You're welcome!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 13 Nov 2008, 00:28
OhgodpleasenomoreCalvinandHobbesslash.com

FUCK YOOOOOOOOOOOU
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 13 Nov 2008, 00:37
You know you love it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 13 Nov 2008, 00:38
(http://img.photobucket.com/albums/v149/Taito_Kisses/1120938481675.png)

wut?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 13 Nov 2008, 01:19
Okay thats it, when did this thread turned into "lets fuck your childhood thread" hmm?...but keep up your good work.



Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 13 Nov 2008, 01:47
Why is there so much Calvin and Hobbes porn? It's so arbitrary. Why not Peanuts porn? Why not Garfield porn? Not that I want or encourage either of those things, but..jesus, why Calvin and Hobbes?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 13 Nov 2008, 02:02
(http://img.photobucket.com/albums/v663/Lapuz/random/peanuts.jpg)?

(http://img.photobucket.com/albums/v663/Lapuz/random/garfodie.jpg)?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 13 Nov 2008, 03:15
/\/ ( O )
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 13 Nov 2008, 03:17
WHHHHHHHHHHHHYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 13 Nov 2008, 03:28
I think i have successfully made it to the bottom of this page without bursting into tears. I'm waiting for a page break.

Screw you guys.

EDIT: aaaargh! I accidentally scrolled down when clicking submit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 13 Nov 2008, 05:59
something else

marry me
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 13 Nov 2008, 10:17
What next? Bloom County? Hagar the Horrible? I've already seen For Better or For Worse. It's like someone put a /34/ on everyone's collected childhoods.

My inner child was touched in a bad place.

Let me show you on the doll...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 13 Nov 2008, 12:06
Guys, it is 7am. You may have noticed when you name something I find some stuff, so the Hagar the Horrible porn will have to wait until this afternoon when I get home, ok?


Also, these things are pretty vanilla compared to the other pictures I have been finding. I mean, I could post a grown up, super muscle Charlie Brown grabbing onto his big dick while snoopy swoons in the background if you want. I am just saying that these things aren't all that bad. They're actually kind of funny!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 13 Nov 2008, 13:09
Oh lord. What.

Why.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: I is Grammar on 13 Nov 2008, 13:14
That's amazing. 
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 13 Nov 2008, 14:00
Guys, it is 7am. You may have noticed when you name something I find some stuff, so the Hagar the Horrible porn will have to wait until this afternoon when I get home, ok?


Also, these things are pretty vanilla compared to the other pictures I have been finding. I mean, I could post a grown up, super muscle Charlie Brown grabbing onto his big dick while snoopy swoons in the background if you want. I am just saying that these things aren't all that bad. They're actually kind of funny!

My question: Where on earth do you find these things? Why do you find them?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scrambled Egg Machine on 13 Nov 2008, 14:08
DO NOT GOOGLE THE FOLLOWING: paheal.net. It will destroy you. I only know becuase of a long and painful relationship with 4chan.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 13 Nov 2008, 16:14
yeah, that's a pretty good site to find stuff. that's where i've gotten the pictures so far, but there are a few other places on my list that I can go look around. I mean, stop sharing these secrets! (note: 4chan's really not that bad in places. Sure the porn comes up in every section, but once you get past that there are perfectly normal parts of it)

I find them because it's fun. I look at the seedy parts of the internet because no matter how weird I think I am, there is proof that there are people out there who are a hell of a lot stranger than I am. Plus, some of them are hilarious. I found a picture of Kanga (from Winnie the Pooh) in full bondage gear, being banged by Santa. How is that not funny? Also because people were getting so distraught by the pretty tame pictures I posted.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 13 Nov 2008, 16:33
Must fight back

(http://img176.imageshack.us/img176/2017/goodendzz4.jpg)

(http://img181.imageshack.us/img181/4815/calvinandsusielh8.jpg)

(http://img395.imageshack.us/img395/4905/chlateryearstb9.jpg)

(http://img395.imageshack.us/img395/1827/dawwfj3.jpg)

(http://img137.imageshack.us/img137/9775/socutewi5.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 13 Nov 2008, 19:09
(http://i137.photobucket.com/albums/q232/scapocy/Dawwww.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 13 Nov 2008, 22:48
WELL I CAN STILLLL BREAATH. (http://uk.youtube.com/watch?v=1fWzXNhfoQ8)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 13 Nov 2008, 23:27
Must fight back

Mang you repeated two of them earlier in the thread.  DOESN'T COUNT
Title: Re: RL Photoshop
Post by: Heavyoak on 13 Nov 2008, 23:37
lol nice
Title: Re: RL Photoshop
Post by: Trollstormur on 14 Nov 2008, 01:26
I am posting this here because I don't know if it should go in the Computers forum or the Art forum.  Anyway, it's Photoshop's interface done in real life!

http://gizmodo.com/5080163/what-photoshop-would-look-like-in-real-life


merged into this thread, check out jho's link.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 14 Nov 2008, 10:21
(http://i214.photobucket.com/albums/cc310/starman_deluxe/ripo_Fragil_Sakristan.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 14 Nov 2008, 11:40
That is some cool motherfucking graffiti.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 14 Nov 2008, 15:12
Thats Epic,i would like to meet the guy who did that
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 14 Nov 2008, 19:59
He would be related to the goatse guy. If you don't know what I am talking about, Google it and then find some hard liquor.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dazed on 14 Nov 2008, 20:07
I highly recommend not googling that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 14 Nov 2008, 20:08
(http://img151.imageshack.us/img151/4408/attemptedjv8.jpg)

(http://img217.imageshack.us/img217/9016/zangiefwj8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 14 Nov 2008, 20:09
WELL I CAN STILLLL BREAATH. (http://uk.youtube.com/watch?v=1fWzXNhfoQ8)

LOOK KIDS! ITS CONDOM MAN!

Edit:
Obameratsu

(http://fc49.deviantart.com/fs35/i/2008/312/7/0/OBAMA_by_spacecoyote.jpg)

I would play that game.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 14 Nov 2008, 20:32
http://img151.imageshack.us/img151/4408/attemptedjv8.jpg

I'm offended by such 'murder humour'.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 14 Nov 2008, 21:00
I'm offended by "faux-offended humor".
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 14 Nov 2008, 21:21
(http://looku.com/imagebin/full/1226325250Shizznet4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 14 Nov 2008, 22:08
Obama = Black Man Pres! Thats epic and sweeeeeet

HotDOG Hahahahaha
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: abadname on 15 Nov 2008, 13:45
(http://i23.photobucket.com/albums/b394/HARVEYxDANGER/dogs.jpg)
They aren't good, but i was bored with 5 minutes in MSpaint.  I'm pretty proud of it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 15 Nov 2008, 14:57
(http://i137.photobucket.com/albums/q232/scapocy/TufKat.jpg)
(http://i137.photobucket.com/albums/q232/scapocy/boingbunny.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 15 Nov 2008, 18:08
(http://fc99.deviantart.com/fs39/f/2008/319/b/d/Headshot_by_RocketShoes.jpg)

Argh, I wish i could do this in the game!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 15 Nov 2008, 19:43
Bert and Ernie Go Brutal (http://www.youtube.com/watch?v=InZNBcJTmWs)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 15 Nov 2008, 21:54
(http://s.buzzfeed.com/static/imagebuzz/2008/11/12/21/9238e974d4d4d3a31d20b7a5a2801d3e.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 15 Nov 2008, 22:23
(http://img.photobucket.com/albums/v12/sademie/T23WCGGXMHFQXBA4SD24JUDXIGNHNU6U.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 16 Nov 2008, 07:17
http://news.bbc.co.uk/1/hi/world/americas/4313978.stm

I wish there was a better way to express this than "fail", but... I don't know.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 16 Nov 2008, 09:14
(http://www.threadbombing.com/data/media/48/obama_miagi.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 16 Nov 2008, 10:22
http://news.bbc.co.uk/1/hi/world/americas/4313978.stm

I wish there was a better way to express this than "fail", but... I don't know.

The best part is if you enlarge the picture, this is the caption:
"The python tried to swallow the alligator whole and then exploded"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 16 Nov 2008, 10:55
I would pay a great deal of money to see firsthand an alligator explode out of a python.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 16 Nov 2008, 11:09
I just love the conclusion the researcher comes to: "Clearly, if they can kill an alligator they can kill other species".



http://weburbanist.com/2008/10/19/ghost-town-abandoned-city-examples-images/

I want to go visit these places.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 16 Nov 2008, 13:14
I've been to Bodie, CA. It's a tourist trap :P
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 16 Nov 2008, 14:03
To be expected probably, but that one in Korea looks pretty weird.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Johnny C on 16 Nov 2008, 14:17
(http://img407.imageshack.us/img407/4401/thrillworldsc6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 16 Nov 2008, 14:19
Do you mean the abandoned amusement park? I'm not sure why that's even noteworthy really, it's not like that's the only abandoned amusement park in the world. Hell, they pop up so much in anime movies, Tokyo must be walled in by abandoned amusement parks.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 16 Nov 2008, 17:40
http://en.wikipedia.org/wiki/List_of_abandoned_amusement_parks (http://en.wikipedia.org/wiki/List_of_abandoned_amusement_parks)

3 of them in japan alone.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 16 Nov 2008, 23:01
Oh FUCK Astroworld (http://en.wikipedia.org/wiki/Astroworld)? I used to go there when I was younger!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 17 Nov 2008, 05:03
What's the word on shutting down the Coney Island astroworld?

That makes me sad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 17 Nov 2008, 06:31
I once wandered Lincoln Park (http://en.wikipedia.org/wiki/Lincoln_Park_(Massachusetts)) near UMass Dartmouth when my friend Walker was in college. The place was creepy as all Hell and it only got worse as the day went on. It was after most of the fires, so there was very little left to the place. One concession stand creeped me out as it was covered with taggings of 3.24 (My birthday). On our way out, there was a creepy guy standing up against a creepy well in the middle of the park. We ended up talking to him and he actually was a pretty cool guy who used to work there and now cut through the park to get to his current job.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 17 Nov 2008, 08:48
(http://img201.imageshack.us/img201/1469/122656722234st4.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wolf on 17 Nov 2008, 13:54
(http://www.pinkcoyote.net/leonardoodle.jpg)
Leonardoodle

here is a link if you would like more ideas on dog grooming.

http://www.pinkcoyote.net/creativegrooming.html
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 17 Nov 2008, 13:55
I remember I knew a guy who thought it was cute when his dog did that, sliding around on his butt. I found out later that dogs do that when their anal glands are inflammed (basically, doggie hemorrhoids.)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: BankHoldUp on 17 Nov 2008, 14:19
Leonardoodle


Is that....is that a live dog?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 17 Nov 2008, 14:31
Would it make you feel better if it were dead?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 17 Nov 2008, 16:10
yes. yes, it probably would.

EDIT: this is not meant to be taken as a slight towards dogs. I love dogs. What I meant is, poor dog. I've always thought dressing up dogs is ridiculous. This is over the top.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 17 Nov 2008, 18:52
(http://img205.imageshack.us/img205/2473/howmuchheroinuu9.jpg)

(http://img515.imageshack.us/img515/9328/inursectorzcu3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 17 Nov 2008, 19:57
Leonardoodle

Oh NO
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: BlahBlah on 18 Nov 2008, 13:15
(http://www.b3tards.com/u/140f53149919acfbe5b4/daily-express-big.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: IronOxide on 18 Nov 2008, 13:31
In what twisted world is -9oC cold?

That is like the average low in January here, and we're not that cold.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: BlahBlah on 18 Nov 2008, 13:35
It's the daily express, everything is exaggerated. The lowest temperature recorded in the UK was -27.2C at Braemar though, so maybe -9 has happened. I can't remember it ever being that cold though.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 18 Nov 2008, 14:05
I can - but I've had more opportunity.  I was alive in (but don't remember!) the winter of 1947, when the temperature in Britain didn't rise above 0°C for six weeks, even in the most southerly parts of England.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Clintaga on 18 Nov 2008, 14:23
Okay so, the next time anyone of you says "I really want to play Guitar Hero, but I also want to go for a bike ride... damn." Just watch this:
http://www.youtube.com/watch?v=NlMYWuGUZlM (http://www.youtube.com/watch?v=NlMYWuGUZlM)
and film the next cool thing you do with your friends, cause that is seriously some insane stuff, maybe, and we'd like to see it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cernunnos on 18 Nov 2008, 15:50
http://www.youtube.com/watch?v=qsPwtJCuC-U
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 18 Nov 2008, 21:22
A related video (http://uk.youtube.com/watch?v=bqg_ceFM30I)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Slick on 18 Nov 2008, 21:36
Johnny Johnny I love that comic that is the best thing I've seen in a long time.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 19 Nov 2008, 04:09
Thats some badass pussy (http://uk.youtube.com/watch?v=X1sOxMX1TO4&eurl=http://gorillamask.net/gm_media.php?show_page=video&page_id=16706)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 19 Nov 2008, 06:37
ANIMALS ARE SO COOL! (http://blog.wired.com/wiredscience/2008/11/top-10-amazing.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 19 Nov 2008, 12:59
I've seen that cat vid before but it's still one of my favorites. I just love how utterly focused they are.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 19 Nov 2008, 13:04
Girl with many facial piercings and what looks like somewhat cheap "vampire fangs" flicking around her split tongue.

I didn't do a direct img link because whiles it's not really NSFW it is still a girl sticking her split tongue out which is close enough.

http://i34.tinypic.com/2zdoti9.jpg

It's horrible (*referring to my own reaction, not to her*) but I can't help thinking that if she had a decent looking pair of fangs I might respect that look more.

I mean she spent the money to split her tongue.  Why not splurge on a decent set?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 19 Nov 2008, 13:22
That is amazing. I still want my tongue split and that just makes me want it more.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 19 Nov 2008, 13:23
Same here. I don't know why you think that's so horrible, but then I don't know why you'd complain about a stranger so much either.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 19 Nov 2008, 13:30
To make things clear I think that the split tongue is awesome.

I found if fascinating because I didn't know that you could move around the two tips independently like that.

It was the fangs that I thought were lame.

I know for a fact you can buy a lot better looking dental appliances then that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 19 Nov 2008, 13:36
Same here. I don't know why you think that's so horrible,

The horrible comment was referring to my insane thought process on the matter.

I mean it really shouldn't matter about the dental stuff considering what she must have went through to get the versatile tongue and all.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 19 Nov 2008, 13:49
I've seen that cat vid before but it's still one of my favorites. I just love how utterly focused they are.

What I love about that video is that right up until the end the cat thinks the cameraman doesn't notice it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Slick on 19 Nov 2008, 14:19
penis.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 19 Nov 2008, 14:38
Excellent pagebreak

http://www.youtube.com/watch?v=s8Y_vEKbZhU (http://www.youtube.com/watch?v=s8Y_vEKbZhU)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 19 Nov 2008, 18:28
Get the rhino man (http://uk.youtube.com/watch?v=PgHQfxT7ImI)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eli on 19 Nov 2008, 18:34
http://www.archure.net/science/UFO.html

The whole website is pretty insane, but that page makes me laugh the most, especially the recording of the "alien voice".
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 19 Nov 2008, 20:05

Have you seen this? (http://www.bertisevil.tv)

A mockery of conspiracy theorists, I think.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 19 Nov 2008, 20:30
(http://img246.imageshack.us/img246/8763/bushkittenud2.jpg)

(http://img227.imageshack.us/img227/7725/frenchdudeswp6.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 19 Nov 2008, 23:41
Get the rhino man (http://uk.youtube.com/watch?v=PgHQfxT7ImI)

Not only was that video amazing, it linked me to this:
http://www.youtube.com/watch?v=mGxde2a2_iQ&NR=1

All seems pretty good until 48 seconds in.

ADDITION: Read the comments, I had no idea.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 20 Nov 2008, 00:02
Japanese spiderman versus Italian spiderman but who would win?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 20 Nov 2008, 04:08
The one with the shotgun.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 20 Nov 2008, 05:40
Not only was that video amazing, it linked me to this:
http://www.youtube.com/watch?v=mGxde2a2_iQ&NR=1

All seems pretty good until 48 seconds in.

I am so confused.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 20 Nov 2008, 05:46
The one with the shotgun.

No way man, my money's on the one with the Mega-Zord.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: öde on 20 Nov 2008, 06:22
Explosive boomerang moustache.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 20 Nov 2008, 06:49
(http://www.transbuddha.com/images/uploads/spiderman2.jpg)(http://www.transbuddha.com/images/uploads/leo.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Bowers on 20 Nov 2008, 07:30
http://www.youtube.com/watch?v=wXhxUhg3uC8 (http://www.youtube.com/watch?v=wXhxUhg3uC8)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 20 Nov 2008, 08:13
(http://roflrazzi.files.wordpress.com/2008/10/darth-vader-but-soft-what-light.jpg?w=500&h=375)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 20 Nov 2008, 11:51
Objectivist singles, your prayers have been answered. (http://www.theatlasphere.com/)

Quote from: thustotyrants
You should contact me if you are a skinny woman. If your words are a meaningful progression of concepts rather than a series of vocalizations induced by your spinal cord for the purpose of complementing my tone of voice
Quote from: Zak
I am rational, integrated, and efficacious. So far, Ive never met a person who lives up to the standard I hold for myself (except online).

Also, THE GAY IS COMING AFTER YOU AND YOUR FAMILY (https://store.afa.net/pc-10000122-5-theyre-coming-to-your-town-dvd.aspx)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: BankHoldUp on 20 Nov 2008, 13:55

Also, THE GAY IS COMING AFTER YOU AND YOUR FAMILY (https://store.afa.net/pc-10000122-5-theyre-coming-to-your-town-dvd.aspx)

I like how one of the related products is a DVD that argues that all homosexuals need to start liking the opposite sex again is a healthy dose of churchin' and a legion of mental health "professionals", like it is some sort of disease. Just wait, next they'll have DVDs with titles like "Follow the Light to the Right: How Jesus Cures the Left Handed".

Also, Hey internet...hey um, hey internet (http://www.nurfed.com/drinkwithcare.mp3)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 20 Nov 2008, 14:08
http://www.youtube.com/watch?v=wXhxUhg3uC8 (http://www.youtube.com/watch?v=wXhxUhg3uC8)

Oh my, where has this been in my life thus far?

http://uk.youtube.com/watch?v=7838Z0EhXFc&NR=1

I'm laughing and crying in the library and I don't care about anyone else or their study habits.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 20 Nov 2008, 17:07
Objectivist singles, your prayers have been answered. (http://www.theatlasphere.com/)

Quotes from that site were featured on the last page of New York magazine last week.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 20 Nov 2008, 18:21
(http://i4.photobucket.com/albums/y147/ThePQ4/2890200141_c9f7eb738b.jpg)

(http://i4.photobucket.com/albums/y147/ThePQ4/funny-graphs-ass.gif)

(http://i4.photobucket.com/albums/y147/ThePQ4/mcgyver-paperclip.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 20 Nov 2008, 19:30
Finally I have something to be proud of in my home city:

Two-headed cat meows through both mouths (http://www.telegraph.co.uk/news/worldnews/australiaandthepacific/australia/3489199/Two-headed-cat-meows-through-both-mouths.html)

BOTH MOUTHS

MEOWS THROUGH BOTH MOUTHS
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thaes on 21 Nov 2008, 00:48
I saw a picture of that cat earlier today, but I thought it was photoshopped (there was no additional info given). Now that I know it's real, however, all I can say is: dang, that thing is adorable. The only thing that could possibly make it neater is if the mouths didn't meow simultaneously, but one after another.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ImRonBurgundy? on 21 Nov 2008, 06:16
http://www.youtube.com/watch?v=qsPwtJCuC-U

When I was a kid, and my family still went to church, David Hart showed up for a stretch of about a month or two.  He would always sit in the back and would sing every single hymn very loudly and to tunes independent of the organist and everyone else.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 21 Nov 2008, 08:07
(http://www.bestweekever.tv/bwe/images/2008/11/jackman-shake.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 21 Nov 2008, 08:50
The elderly really receive you quite well.  They're lonely and they long for touch. (http://www.godtube.com/view_video.php?viewkey=2ed984fb50edca1df9df)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 21 Nov 2008, 20:25
(http://img156.imageshack.us/img156/5489/homeizherevv2.jpg)

(http://img165.imageshack.us/img165/9870/starroheadonlv2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 21 Nov 2008, 21:44
NSFW, but WHAT. (http://www.bmezine.com/pierce/08-nipple/A70705/high/bmepb548738.jpg)


this picture is awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 21 Nov 2008, 21:54
HOLY CRAP

That's either a really good photoshop or a really bad mole.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 21 Nov 2008, 21:56
Or a third nipple. They happen on occasion.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 22 Nov 2008, 04:52
Third nipple, I assume. They're not uncommon, I know a few people with them.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 22 Nov 2008, 07:25
Three is unusual but four is bizarre.

I'm still not sure where my extra pair came from.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 22 Nov 2008, 07:42
One of my friends has five nipples in total. When she showed me the extra ones it made me really queasy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 22 Nov 2008, 07:48
Jesus christ. That is far too many nipples.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dazed on 22 Nov 2008, 08:27
Holy areolae batman
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 22 Nov 2008, 09:08
Or a third nipple. They happen on occasion.

You learn something new everyday, it seems.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 22 Nov 2008, 09:37
Oh yeah, I have a friend with a third nipple that she's thinking about piercing as well.

I think what is so unsettling about that one though is that it is as big and normal looking as the others. My friend's doesn't look exactly like a real nipple should, it's kind of just something that's there.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wolf on 22 Nov 2008, 10:48
cool meteor caught on camera

http://www.youtube.com/watch?v=Gk8gX7vf6-4&feature=related (http://www.youtube.com/watch?v=Gk8gX7vf6-4&feature=related)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 22 Nov 2008, 14:01
The hell? I know people occasionally have more than two nipples, but the fact that the majority of respondents to that picture have been like "aw yeah man, I have a friend who has 20 nipples, they're gonna get that shit pierced" is disconcerting to say the least.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Oli on 22 Nov 2008, 16:08
I do not know anyone with extra nipples. You freaks.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 22 Nov 2008, 20:19
Only me, really.

(As in I'm the only one who responded with a story of a many-nippled friend, not I'm the only one with extra nipples)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 23 Nov 2008, 05:33
I wonder... If a woman has extra nipples, are they functional? Seems it would be cool if she had triplets... Or Quads!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 23 Nov 2008, 08:43
This is one of the few times where I've been physically incapable of watching this to completion. It is just.. fuck man THIS is why we can't have nice things.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 23 Nov 2008, 13:28
See, this is why I've always argued that there needs to be some sort of operator's license requirement before you're allowed to use a vocoder.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tybalt on 23 Nov 2008, 15:01
http://superbad.com/ (http://superbad.com/)

Click on stuff.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tommydski on 23 Nov 2008, 15:22
That Brokencyde video is just remarkable. These people have nothing approaching a good idea. As a band, they might have the highest ratio of bad ideas I have ever seen. In particular the woeful, downright offensively ignorant lyrics and the dude who just inexplicably does his little girly scream every six seconds during the verses, despite the fact that it doesn't work in the context of the song at all. In the video he is dancing with a girl and doing the faux-screaming thing into her face. How she can avoid just full on laughing is beyond me.

I can only assume from the way they look that they actually, genuinely want to be stabbed. I feel like if you saw them and you had a knife, you'd pretty much have to oblige them.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 23 Nov 2008, 16:12
Oh boy, I had to force myself to reach 1:01.

You know what makes me sad? This looks like something that will become popular.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 23 Nov 2008, 16:15
Stuff Ptommy said.

Yeah, I mean, even ICP is at least making a really stupid attempt at morality tales. These guys aren't even putting effort into their terrible ideas, it's just incredibly lazy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 23 Nov 2008, 17:14
I couldn't make it past about :30 or so. My God, that is beyond the worst thing ever attempted.
Oh, and:

(http://i36.tinypic.com/2ltj8l1.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 23 Nov 2008, 17:45
I couldn't even keep watching it past about 20 secs without sound.  I will try again when I get home, but I predict repulsion.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 23 Nov 2008, 17:46
Correctly predicted, sir
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 23 Nov 2008, 19:49
I saw this a while back and was momentarily excited:

(http://img.photobucket.com/albums/v371/est_xplosif/random/if_only.jpg)

Then I realise it probably wasn't what I was hoping it would be.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 23 Nov 2008, 20:04
Dammit tragic_pizza that thing is going to eat my face.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 23 Nov 2008, 20:50
That thing reminds me of so much terrible mid-nineties web design. Maybe that's because all the web design I saw during that time were the flash game websites that I frequented during computer classes at highschool.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 23 Nov 2008, 21:16
Dammit tragic_pizza that thing is going to eat my face.
Then my work here is done.
    /
 :-D
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 24 Nov 2008, 01:04
Oh. My. God.

Brokencyde is probably at least up there in the top 5 worst things to ever happen to music. At least they shot the video in the suburbs, where more than 70% of their fanbase will more than likely come from. Rich suburban white kids will eat this shit up. I say this because I grew up in the city, and for the most part, had never met a "scene kid," but when I moved to a predominately rich, white, suburban area, they were everywhere.

Jesus. It's just terrible.


Also, the best part actually starts at 1:54.

To quote their myspace, "such a talented band love your music to death"

sigh.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 24 Nov 2008, 01:21
Why does the guy feel it necessary to shriek every 3 seconds? Half the time it's not even on a beat, it's just completely and utterly random; there's not even any rhythmic quality to it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 24 Nov 2008, 02:32
Brokencyde also has a song called Sex Toyz. And let me tell you, the lyrics are pure genius. (http://www.sweetslyrics.com/570679.Brokencyde%20-%20Sex%20Toyz.html)




Also, I have found this picture and it makes me 8 different kinds of happy.

(http://i137.photobucket.com/albums/q228/andlemonade/Panda-1.jpg)

That is Neil Gaiman guys. And he is getting all snuggly with a panda!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 24 Nov 2008, 02:38
Oh, jesus fucking christ, those are not lyrics, those are shit in written form.


Suddenly, I feel about a million times better about listening to NIN all the time as a highschool freshman. Compared to these people Trent Reznor should be our national poet laureate.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 24 Nov 2008, 02:43
Man, don't hate on NIN. I love Trent Reznor. One of my mixes I have been listening to a lot lately actually has a lot of NIN on there.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 24 Nov 2008, 02:45
NIN was too big a part of my musical experience as a young man to truly hate on. I own all of the major releases and Trent is in no way as lazy as these fuckers. But the man's lyrics? They're not so good.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 24 Nov 2008, 02:49
Admittedly, the man is not a lyrical genius, but he is better than a good deal of the more popular acts out there.

Also, I feel really silly saying this, but he makes some really pretty music.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KvP on 24 Nov 2008, 04:38
Don't forget the muscles.

The angry, angry muscles.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 24 Nov 2008, 04:42
Reznor makes some pretty neato sounds. He is just a silly, angry li'l man sometimes, that's all.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: allison on 24 Nov 2008, 04:54
Man there is nothing silly about that. NIN is highly acceptable, if for nothing else then at the very least the amazing art direction makes it worth checking out.

Rob Sheridan is their art director and he is possibly one of the funniest, smartest and most genuine people I've ever seen. I'm a huge fan of all his work - he's got a blog and he also does his own art on the side. You should check it out.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 24 Nov 2008, 05:02
NIN is a gool guy eh wants to fuck you like an animal and doesn't afraid of anything.

Also now I see Rollins' angry, angry nipple when I close my eyes. Thanks for that. Oughtta just install a hinge in my skull the amount of times I need to scrub my brain...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cernunnos on 24 Nov 2008, 05:33
http://www.youtube.com/watch?v=hKBn_mm8nzc
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 24 Nov 2008, 06:14
I saw this a while back and was momentarily excited:

<Steven Seagal Pistol Whipped>

Then I realise it probably wasn't what I was hoping it would be.
I just read the synopsis on that movie. It's like a bad version of The Punisher, except instead of killing criminals for vengeance he kills criminals because he's a drunk with a huge gambling debt.

Shame... That title, if done right, could have been the BEST MOVIE EVAR! Particularly if it co-starred Ray Liotta (http://www.youtube.com/watch?v=XqKhQc_pyQM).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 24 Nov 2008, 09:00
The comments on that make me laugh.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 24 Nov 2008, 10:30
Oh my god that was fabulous.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 24 Nov 2008, 10:45
My mind.. she is blown.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 24 Nov 2008, 11:36
I love how amongst all of the enthusiasm and praise (sarcastic or otherwise) there is one lone poster asking a question that truly comes from the heart: "What the F*** is wrong with you people?"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CamusCanDo on 24 Nov 2008, 13:46
EAT MY MEAT (http://www.fakku.net/images/councilwinner.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 24 Nov 2008, 18:17
(http://www.whatisdeepfried.com/COMIX/Family/CLARISSA-12.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ThePQ4 on 24 Nov 2008, 18:58
It's A Wonderful Internet (http://www.itsawonderfulinternet.com/) (...Hope this isn't a repost, but I don't think it is)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 25 Nov 2008, 00:32
less yap more crap

(http://www.mocpages.com/user_images/4053/1201674818_DISPLAY.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 25 Nov 2008, 00:35
    There was a young man from Peru,
    Who had nothing whatever to do;

        So he took out his carrot
        And he fucked his parrot,

    And sent the result to the zoo.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 25 Nov 2008, 11:20
Those Lego Futurama figures are pretty cool.  You can build pretty much anything with Lego.

And now, a family portrait (not mine):

(http://i184.photobucket.com/albums/x5/dmg1969/Lostmanhood.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 25 Nov 2008, 14:05
It's looks like it was the woman's idea since she seems to have a genuine smile on.

However, the man's eyes are dead.  Cold and dead.

This is not how he wanted his life to end up.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 25 Nov 2008, 15:58
I pity the child the most, it was brought into this.

(http://img179.imageshack.us/img179/2671/specialneedsdebatecs3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 26 Nov 2008, 00:07
Thats awesome,Palin hating is so much fun lol
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 26 Nov 2008, 00:59
I hope she never fades into obscurity.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 26 Nov 2008, 01:03
I like that if it was just the baby in that costume it would be the cutest thing ever, but add in the adults and creeeepy.

Seriously look:

(http://i9.photobucket.com/albums/a55/ddovey/bubs.jpg)

Awwwwwwwwwww

(http://i184.photobucket.com/albums/x5/dmg1969/Lostmanhood.jpg)

Aaaaaaaaaggghhhhhh
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CamusCanDo on 26 Nov 2008, 01:07
I dunno man. That baby looks pretty creepy if you just sit there and stare for a few minutes, as if someone shaved a bear face and that's what was underneath.

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 26 Nov 2008, 01:11
that's not creepy that's awesome
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Elizzybeth on 26 Nov 2008, 01:19
(http://img.photobucket.com/albums/v321/NvrTooMuchPython/050612-100.jpg)

And they're even cuter underneath all that fur...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 26 Nov 2008, 04:48
(http://cassland.org/images/odd/1.jpg) (http://cassland.org/images/odd/5.jpg)
(http://cassland.org/images/odd/4.jpg) (http://cassland.org/images/odd/2.jpg)
(http://cassland.org/images/odd/3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: allison on 26 Nov 2008, 06:44
http://www.youtube.com/watch?v=OqGQ72bre30
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 26 Nov 2008, 06:46
Okay this page needs to break. I'm starting to hate that picture of Henry Rollins.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blank_Jebus on 26 Nov 2008, 07:07
I'm sorry, but this shit (http://www.collegehumor.com/video:1825193) was hilarious


speaking of the Olympics, this has to be, by far, my fav gif ever.
(http://c2.ac-images.myspacecdn.com/images02/14/l_9ed601a5624048f8aaf80c0cbd765325.gif)



btw, sorry if this was posted already, but i love it...makes me laugh everytime
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 26 Nov 2008, 07:13
Man, this page is so in need of breaking.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 26 Nov 2008, 07:39
Seriously.  I hate that fucker.  Phelps is a douche.


Wait, that was back in August.  Fuck, dude.


And on the off chance this is a pagebreak:

penis.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 26 Nov 2008, 07:42
Okay penis didnt work: let's try:

cocksnout

That worked one time.

EDIT: Dammit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 26 Nov 2008, 07:46
Gonna break!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 26 Nov 2008, 07:46
EVERYTHING YOU SAY TO ME, PUTS ME ONE STEP CLOSER TO THE EDGE!

PAGE IS GONNA BREAK!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 26 Nov 2008, 07:48
Fuck you for stealing my page break, you bastard.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 26 Nov 2008, 07:55
Next I'll steal Jens from you.
Just give me time.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 26 Nov 2008, 07:56
Man, I will fight you. You will not win.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 26 Nov 2008, 08:57
Man, talk about Mutually Assured Frustration. I'm seeing fencing with radioactive flaming swordfish.

Thanks for the page break, by the way.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 26 Nov 2008, 09:05
Man, I will fight you. I will not win.

I fixed it for you.
You forget that I do Kung Fu. It is not just a physical thing. They teach us tricks.
Mind tricks.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 26 Nov 2008, 09:07
Mind tricks only work on the weak minded.

Also you are a twig. I could break you in half. Leave my Jens alone.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 26 Nov 2008, 09:10
These are not just regular mind tricks. They are italicized mind tricks.

Much more powerful. I AM NOT A TWIG! I weigh like 140 lbs. The parts that are not bone or skin are muscle. I am tired of people making fun of me for being skinny.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 26 Nov 2008, 09:16
Jace I outweigh you. And I am tenacious. You will not win.

Plus, pickaxes:
(http://photos-d.ll.facebook.com/photos-ll-sf2p/v182/145/89/33809847/n33809847_32369859_720.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 26 Nov 2008, 09:35
(http://farm2.static.flickr.com/1013/1385722163_f2facbccf7.jpg?v=0)

(http://www.peoplecorporation.org/post_images/7494_kungfu-panda-funny.jpg)

(http://www.peoplecorporation.org/post_images/1782_sport_stupid.jpg)

(http://www.peoplecorporation.org/post_images/1947_toilet.jpg)

(http://www.peoplecorporation.org/post_images/682_names.jpg)

(http://img369.imageshack.us/img369/2187/clipboard288jt3.jpg)

(http://img501.imageshack.us/img501/2100/clipboard365cd5.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 26 Nov 2008, 09:39
Jace I outweigh you. And I am tenacious. You will not win.

You may be tenacious, but I have a heart of fire. And the bone structure and chi flow of a Kung Fu master! I'll use the buddha palm technique on you.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 26 Nov 2008, 11:21
I'm a redneck. I'll kick ya both down and walk out with jens and a case of Pabst.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 26 Nov 2008, 11:34
Be careful, Jens is a knight.
(http://s10.photobucket.com/albums/a127/r3an1m4t3d/nordicknight2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 26 Nov 2008, 11:37
OK, well, Miller High Life, then.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 26 Nov 2008, 12:37
D'awww, he's such a sweetheart.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 26 Nov 2008, 12:39
Well, of course, he does have a strict code of chivalry to follow.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 26 Nov 2008, 16:11
(http://img246.imageshack.us/img246/1394/smoothtrooperbygoergen1do3.jpg) (http://imageshack.us)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 26 Nov 2008, 18:41
Oh my god you two stop fighting or I will eat you.  Don't think I won't, I'm big enough to do it.

(http://img151.imageshack.us/img151/4814/creepyeelzo4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 26 Nov 2008, 19:30
That totally looks like a grown-up version of the fetus from Eraserhead.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 27 Nov 2008, 00:26
http://www.spike.com/blog/woman-blows-mic-as/70905 (http://www.spike.com/blog/woman-blows-mic-as/70905)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 27 Nov 2008, 08:34
This is why modern art can suck a fat one.

Pun not intended.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 27 Nov 2008, 11:26
You know damn well that the pun was intended.
I might even say you had the gall to actually think about it and plan it out.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Barmymoo on 27 Nov 2008, 12:07
Here is a replica of a poster that someone has put up in my college (the actual one is handwritten and looks just like a "missing cat" poster).

(http://img.photobucket.com/albums/v614/barmymoo/awesomecat.jpg)

It is my favourite poster ever.

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 27 Nov 2008, 18:16
Man, the first two mic blowjobs aren't even any good.  The third one would probably be passable, but they are definitely all more "I learned how to suck cock by watching porn" than something based on male physiology.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 28 Nov 2008, 17:04
i know, i know they saw his avatar (it drives people to madness)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: SonofZ3 on 28 Nov 2008, 17:37
The first of the Lord of the Rings movies is on tv tonight, but I prefer the oldschool lotr movies:
http://www.youtube.com/watch?v=YdXQJS3Yv0Y
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 29 Nov 2008, 00:34
http://www.youtube.com/watch?v=iXJnOjAGR24


The best float in the Macy's day parade
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CarrionMan on 29 Nov 2008, 00:41
Are you friggin serious?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 29 Nov 2008, 00:49
I did not ever know that a meme could die.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 29 Nov 2008, 03:12
I didnt see that coming but it was totally awesome (and yes i like that song)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Sox on 29 Nov 2008, 03:50
Why would they get Rick Astley to show up on a macys float, all the way from the UK, just to lip synch to an edited version of the song? Seems like a wasted oppurtunity.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 29 Nov 2008, 12:24
Meh, not so sure. I was watching that live and totally didn't expect it, so it caught me off guard completely. Also, everyone lip synchs in the Macy's parade, it would be impossible to get everyone hooked up.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 29 Nov 2008, 19:46
(http://img149.imageshack.us/img149/8214/darkknightbz8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 30 Nov 2008, 03:05
I don't know whether that is sad or hilarious.

Way to make me ambiguous, jerk.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 30 Nov 2008, 04:17
ooo assassins,cool


Apples = Boom Heh
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 30 Nov 2008, 12:37
I love cake.

http://ca.youtube.com/watch?v=VPiGi2L_DTc
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 30 Nov 2008, 15:51
murdered by daft punk.

those guys are dicks.


edit: YOU GUYS YAP TOO MUCH, POST MORE CRAP, FAGGOTS


(http://i472.photobucket.com/albums/rr87/spacemag/askbeartato-shortarms.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 30 Nov 2008, 19:25
FUCK YEAH DOUBLE POST

(http://img.photobucket.com/albums/v12/sademie/twoweiners.jpg)
(http://img.photobucket.com/albums/v12/sademie/whatdoyourelf.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 30 Nov 2008, 21:40
(http://newmedia.funnyjunk.com/pictures/1208269453075.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Misereatur on 01 Dec 2008, 03:39
(http://i68.photobucket.com/albums/i2/ffgtthttghyujjfdss/plantotakeoverworld.jpg)

http://www.youtube.com/watch?v=3gu0iu0xwls
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 01 Dec 2008, 06:11
The best comment on that video:

"the fifth kid, HOLY GOD! SHE'S EATING MY SOUL"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 01 Dec 2008, 07:38
(http://www.margomitchell.com/thc/your_mom_4C_loRES.gif)

tee hee
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 01 Dec 2008, 11:57
D'aww, my mom's my favorite flavor, too!

We have so much in common.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 01 Dec 2008, 12:04
http://uk.youtube.com/watch?v=LpXg3nUCkuo

killer frogs!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 01 Dec 2008, 15:55
I'm not gonna lie. i fuckin' love bullfrogs.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 01 Dec 2008, 18:10
(http://farm4.static.flickr.com/3161/2929776317_1e7fc7bd46_b.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 01 Dec 2008, 21:02
Whoa
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 01 Dec 2008, 21:08
I present to you the answer (http://www.youtube.com/watch?v=N0gb9v4LI4o) to all your storage problems (http://www.jonesbigasstruckrentalandstorage.com/).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 01 Dec 2008, 21:11
that's my new desktop.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 02 Dec 2008, 06:21
(http://www.mrwiggleslovesyou.com/comics/rehab477.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 02 Dec 2008, 07:02
Thats awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WelshPete on 02 Dec 2008, 09:50
(http://i160.photobucket.com/albums/t173/WelshPete/knuttz_ueba_36-1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 02 Dec 2008, 10:22
Epic.

That kid in the back is all like *OMG NO WAI HE BROK MEH CASTLE!!!*
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 02 Dec 2008, 11:58
(http://s10.photobucket.com/albums/a127/r3an1m4t3d/explanation.jpg)

He does many things, the sand bearing child.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 02 Dec 2008, 12:05
WHERE DID THE CHILD IN THE BACKGROUND GO?

I think Baby Explanation ate him. And has gas. Thus, the facial expression.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 02 Dec 2008, 12:30
(http://img231.imageshack.us/img231/8593/sealvh3.png)

(http://img147.imageshack.us/img147/9955/procrastinationom4.gif)

(http://img147.imageshack.us/img147/5673/firetrainye7.jpg)

(http://img231.imageshack.us/img231/4337/futuramadc1.jpg)

(http://img147.imageshack.us/img147/319/427767s1no7.jpg)

(http://img147.imageshack.us/img147/2169/k316y1mq2cc3.jpg)

(http://img388.imageshack.us/img388/5141/smerraridl0.jpg)



some/most/all have probably been posted before but in PT1 and are probably broken by now WHATEVER
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 02 Dec 2008, 15:38
WHERE DID THE CHILD IN THE BACKGROUND GO?

I think Baby Explanation ate him. And has gas. Thus, the facial expression.


Epic.

That kid in the back is all like *OMG NO WAI HE BROK MEH CASTLE!!!*



hey, you. post more crap.


(http://www.comicblasphemy.com/comics/2008-12-01.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 02 Dec 2008, 20:24
Moar crap you say? How bout my favorite thing from last Pointless Thread?

(http://i33.tinypic.com/o9ll3t.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 02 Dec 2008, 20:32
Man, I can think of a lot of things more awesome than the house band at DragonCon '83.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 02 Dec 2008, 20:41
(http://newmedia.funnyjunk.com/pictures/fuck-the-rain.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 02 Dec 2008, 20:43
Like that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 02 Dec 2008, 21:25
You can hear his voice in your head

(http://img384.imageshack.us/img384/8512/dreamak0.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 02 Dec 2008, 22:14
(http://www.picklebird.com/picklebird2.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: michaelicious on 02 Dec 2008, 23:06
Holy shit it winks!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 02 Dec 2008, 23:41
The Thornberries!

That voice is going to be in my head while I try to fall asleep now.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 03 Dec 2008, 00:41
(http://i211.photobucket.com/albums/bb216/dynovideo/bunny.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 03 Dec 2008, 09:14
wut
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: bicostp on 03 Dec 2008, 09:28
I present to you the answer (http://www.youtube.com/watch?v=N0gb9v4LI4o) to all your storage problems (http://www.jonesbigasstruckrentalandstorage.com/).

Hey, that's right down the street from Big Bill Hell's Cars (http://www.youtube.com/watch?v=4sZuN0xXWLc)!

Language warning for those of you sneaking in some internet time at work
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 03 Dec 2008, 21:25
(http://media.fukung.net/images/10691/chemistryyou.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 03 Dec 2008, 22:01
This ladies' queefs (http://www.spikedhumor.com/articles/169352/Kazoo-Player.html) sound like the U.S. National Anthem!


It's work safe, don't worry.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 03 Dec 2008, 22:18
(http://img389.imageshack.us/img389/7091/modokmo4.jpg)

(http://img368.imageshack.us/img368/9124/santadarkseidpd9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 03 Dec 2008, 23:58
Prop 8 - The Musical (http://tinyurl.com/5qj7sz)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Runa on 04 Dec 2008, 00:45
(http://img.photobucket.com/albums/v98/crimsonstitches/LOLREDRANGER.gif)

(http://img.photobucket.com/albums/v98/crimsonstitches/FURRIES2.jpg)

(http://img.photobucket.com/albums/v98/crimsonstitches/vikingemo-1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 04 Dec 2008, 08:40
That Santa Claus one is sweet!


I've only seen House a few times, but as far as I can tell, the plot is always the same, and goes something like this:

(http://thef0ng.com/sazzafrazz/house.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 04 Dec 2008, 08:47
You missed the part where House is wrong about the first drug.  Then everyone is like "oh house is wrong and an asshole but it's okay he's a good doctor"

Later, House sees a random thing in life and says "oh that's right i'm a good doctor i forgot for a while no big deal guys"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 04 Dec 2008, 08:47
You are right on the money there
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 04 Dec 2008, 09:00
Wait, where's the part where House takes some of the drugs too? Or are we past that?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 04 Dec 2008, 09:28
A bit late, but what the hell:

http://www.musicweb-international.com/classrev/2007/Apr07/Cage_433.htm (http://www.musicweb-international.com/classrev/2007/Apr07/Cage_433.htm)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Runa on 04 Dec 2008, 10:19
(http://img.photobucket.com/albums/v98/crimsonstitches/war.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 04 Dec 2008, 16:05
That was both really awesome and really, really long.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 04 Dec 2008, 16:42
Well, World War II was kinda long.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 04 Dec 2008, 16:47
Didn't Roosevelt attempt to end the war quickly by flying a MISSION ACCOMPLISHED banner on an aircraft carrier?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Runa on 04 Dec 2008, 18:10
I GOT NUKES!

Despite the fact that it's long, I still can watch/read it over and over.

Edit:

Found this bundle of awesome-ness in my photobucket just now. I wanted to share.

(http://img.photobucket.com/albums/v98/crimsonstitches/zombiepostcard.jpg)

Boo at it being so damn small.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 04 Dec 2008, 22:31
I would hate horny zombies.


Draw music (http://www.youtube.com/watch?v=gDaj3tBSM2M&eurl=http://www.hilavitkutin.com/)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: IronOxide on 05 Dec 2008, 04:49
http://news.bbc.co.uk/2/hi/asia-pacific/7766666.stm (http://news.bbc.co.uk/2/hi/asia-pacific/7766666.stm)

Just so you know, this is the exact same way people feel about you when you don't give up the guitar hero controller as well.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 05 Dec 2008, 11:26
i'm not going to lie, i definitely shed a tear or two when i saw this (http://www.youtube.com/watch?v=3XJQTaC-R6w&eurl=http://www.dlisted.com/&feature=player_embedded)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Lise on 05 Dec 2008, 11:33
Happy Holidays, everyone!  :wink:

(http://img390.imageshack.us/img390/9909/santaexhibitionistil9.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 05 Dec 2008, 19:18
Jingle Balls?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 05 Dec 2008, 20:37
Ow...my head
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 05 Dec 2008, 21:43
(http://img361.imageshack.us/img361/1871/unicornwh0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 05 Dec 2008, 21:50
Wasn't there a clusterfuck of eegra stuff about 10 pages back or so?  I can't recall.  Whatever, death unicorns are sick.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 05 Dec 2008, 21:59
I am a little disturbed by the tiny unicorn dong.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 06 Dec 2008, 02:37
http://www.whoppervirgins.com/ (http://www.whoppervirgins.com/)


I applaud burger king. Finally, fast-food giant striving to bring indigestion to unwashed chinese peasants.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 06 Dec 2008, 07:28
McDonalds already did that ... like ... five years ago (http://www.chinadaily.com.cn/en/doc/2004-01/15/content_299083.htm)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 06 Dec 2008, 14:20
(http://i12.photobucket.com/albums/a223/ievil/covers/16ordered_to_love.jpg)

fap fap fap fap fap fap
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 06 Dec 2008, 14:32
Your avatar compliments that post too well.

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 06 Dec 2008, 14:39
FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP FAP   :-D (YOUR AVATAR)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 06 Dec 2008, 20:06
(http://img367.imageshack.us/img367/1212/gorgeouseq2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 06 Dec 2008, 20:09
wut
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 06 Dec 2008, 20:09
(http://img.photobucket.com/albums/v12/sademie/fuuuuuuuuuuuuuuu.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 06 Dec 2008, 20:10
Man, nature is such a cruel bastard sometimes.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 06 Dec 2008, 20:17
That Wall-E pic would maybe be funny if it was legible?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 06 Dec 2008, 20:41
No, Dovey. It wouldn't.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 06 Dec 2008, 20:43
I couldn't tell because I can't read it
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 06 Dec 2008, 20:51
--But listen! She never actually said "no"--So its ok.
--No dude. She was hibernating
--  but!
--    No
--Wall-e, what you did is RAPE, you raped Eve
you. look. Gorgeous!

I'm pretty sure either this or something very similar was already posted.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 06 Dec 2008, 21:07
Probably, it came from the Punks and Nerds Doug thing where he rapes Pattie.  I think I also found a better Wall E one where he is talking to Mo.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 07 Dec 2008, 09:30
(http://www.bigactive.com/classes/img/largeimg.php?f=/items/illustration/genevievegauckler/foodchain/alldejections.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 07 Dec 2008, 10:29
Poop.

Things eat your poop.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 07 Dec 2008, 11:33
Fork Lift Safety Is Important! (http://www.spikedhumor.com/articles/169542/German-Forklift-Safety-Video.html)

Some kind Final Destination training video.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 07 Dec 2008, 12:22
awww yeah
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 07 Dec 2008, 16:30
Chemistry safety (http://www.youtube.com/watch?v=4PUZNj1j1eU) is also important (http://www.youtube.com/watch?v=Xx1ZX6u9t9Q&feature=related)

Kids, don't let modesty make your injury worse!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Bowers on 07 Dec 2008, 18:47
he so walked behind him on purpose!
look at his fucking face
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 07 Dec 2008, 18:49
In my high school it was a measure of pride how many times you've seen that video. I only saw it once, sadly.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 07 Dec 2008, 18:52
I love the first one. The hand is like "oh fuck oh fuck, what have I done, wow that was stupid"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 07 Dec 2008, 19:02
STOP LOOKING AT ME WHEN I'M NAKED YOU ASS.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 07 Dec 2008, 19:07
In my high school it was a measure of pride how many times you've seen that video. I only saw it once, sadly.

I had the privilege of watching that video three times
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 07 Dec 2008, 19:10
New theme:  (http://www.youtube.com/watch?v=ZLYUguo0uNM)Stupid (http://www.youtube.com/watch?v=6yGJsEPlyHQ) safety  (http://www.youtube.com/watch?v=7OwJVNzMvH8)films? (http://www.youtube.com/watch?v=I-Boa5eESR0)

"Shake Hands With Danger" was a requirement for my surface mininig certificate.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 07 Dec 2008, 19:20
If there's one thing that safety films has taught me, it's that if there's a container of compressed gas it will always get knocked over and turn into a giant projectile.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 07 Dec 2008, 19:22
God that narrator was boring.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 07 Dec 2008, 20:00
If there is one thing safety films have taught me it is that people will glass-eyedly perform stupidly dangerous shit in a rote, detached and mechanical fashion if someone in a voiceover/loudspeaker explains what is about to happen in an exceedingly boring monotone.

Always wear earplugs in the DANGER ZONE, people.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 07 Dec 2008, 20:08
The music in that video was hilarious, but honestly you take safety videos (even stupid ones) a lot more seriously after you see some of the crazy stupid shit people do. It's one area of life where I am sometimes the humorless prick that everyone else is annoyed by; I can't help it. Y'know, the sort of humorless person summed up by this lightbulb joke:


Q: How many overly cautious lifeguards does it take to change a lightbulb?


A: That's not funny.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 07 Dec 2008, 20:23
In my high school it was a measure of pride how many times you've seen that video. I only saw it once, sadly.

In my home town, it was however many times you saw the movie The Miracle of Life, it was basically a movie that followed from conception to a very messy, very real, live birth full on view. Depending on which school you went to and which classes you took, you could catch this video multiple times between junior high and high school. I was unlucky enough to see it 3 times. Once in 7th grade Life Science, once in 9th grade biology, and in my 11th grade AP biology class. that movie is brutal guys. Like, if I remember right I think the mother chose not to have an epidural. Not so much a measure of pride at watching it but more in commiseration with other put through it. I mean, totally not prepared as a 7th grader for that, though I remember all of our reactions to that scene were priceless in that class. It was that teacher's first year at the school and I think she may have been reprimanded for showing it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 07 Dec 2008, 20:31
Oh christ, that movie.  I had to watch that in 7th and 11th.  We also had a guy come and show us STD slides (strange colored genitals...like silver).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 07 Dec 2008, 20:52
The music in that video was hilarious, but honestly you take safety videos (even stupid ones) a lot more seriously after you see some of the crazy stupid shit people do. It's one area of life where I am sometimes the humorless prick that everyone else is annoyed by; I can't help it. Y'know, the sort of humorless person summed up by this lightbulb joke:


Q: How many overly cautious lifeguards does it take to change a lightbulb?


A: That's not funny.
Oh, I get it. It isn't funny that, at least 1-2 times a week, the ambulance carries someone off from here.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 07 Dec 2008, 21:24
Found it

(http://img205.imageshack.us/img205/2909/rapeeveyc7.jpg)

What's going on? (http://au.youtube.com/watch?v=Ckb-wUHj9WU)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 08 Dec 2008, 01:45
that ninja thing is totally awesome when Eagles - peacegul easy feeling is playing
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 08 Dec 2008, 02:50
i do all the drugs like shark (http://au.youtube.com/watch?v=EouPjJLub2c&feature=related)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: supersheep on 08 Dec 2008, 08:05
Sigworthy!

Also, that forklift video is hilarious. So over the top.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 08 Dec 2008, 10:30
(http://img223.imageshack.us/img223/4262/howmanydigitsofpidoyoukpl8.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 08 Dec 2008, 10:52
I guess I'm a dick... But then I cheat and use a mnemonic. There's a simple little rhyme which, if you can memorise it, will enable you to remember Pi to 20 digits. Simply count the number of letters in each word (including the title) for the relevant digit. In order to help people avoid getting confused I've omitted the punctuation. That was intentional, not just me being a smeghead.

(http://homepage.ntlworld.com/richard.townsend1/pi-pie.jpg)

I'm assuming here that you *want* to remember Pi to more than 4 or 5 decimal places. If you don't then... Ok, mea culpa.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 08 Dec 2008, 11:51
Thats awesome.


Vary handy thanks.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 08 Dec 2008, 13:16
i just remember it to 3.14159, I read this autobiography by an HFA fella who had synaesthesia for numbers and letters and words so he would associate shapes and colors for numbers, and because of this words and numbers had individual identities to him, rather than non-connected symbols representing concepts. This caused him to be able to set the record for recitation of Pi decimal places(it was later broken by a jap) and learn Icelandic in a week.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Clintaga on 08 Dec 2008, 13:27
Did you guys know the Eiffel Tower is married?

http://www.telegraph.co.uk/news/newstopics/howaboutthat/2074301/Woman-with-objects-fetish-marries-Eiffel-Tower.html (http://www.telegraph.co.uk/news/newstopics/howaboutthat/2074301/Woman-with-objects-fetish-marries-Eiffel-Tower.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 08 Dec 2008, 13:31
(http://newmedia2.funnyjunk.com/pictures/churchwars.jpg)

DOGS DO NOT GO TO HEAVEN, THIS IS NOT OPEN FOR DEBATE
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: BankHoldUp on 08 Dec 2008, 13:49
Everyone (http://au.youtube.com/watch?v=oRtrqhVe3Ao) loves (http://au.youtube.com/watch?v=5FD0nIXZpVQ&feature=related) Magical (http://au.youtube.com/watch?v=YKmbyXE8BOA&feature=related) Trevor (http://au.youtube.com/watch?v=Bi0jVq26CUs&feature=related)

Also, FREE DOG SOULS? I AM SO THERE!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 08 Dec 2008, 14:02
i found out yesterday that 'the wire' is barack obama's favourite television show too!
maybe everyone already knows this and it isn't actually all that exciting but i got pretty excited.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 08 Dec 2008, 14:55
*Ahem*
(http://i137.photobucket.com/albums/q232/scapocy/Jor_El.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 08 Dec 2008, 15:22
Quote
A comic about an M1A1 Abrams tank, commanded by a black guy, thats protected by the restless spirit of a Confederate Civil War General. And they're related.

(http://img176.imageshack.us/img176/6373/hauntedtankxv8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 08 Dec 2008, 15:33
Did you guys know the Eiffel Tower is married?

oh dear

Quote
she claims to have a physical relationship with a piece of fence she keeps in her bedroom.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 08 Dec 2008, 15:51
(http://www.headinjurytheater.com/images/zombie%20jesus%20jared%20hindman.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 08 Dec 2008, 18:11
Quote
A comic about an M1A1 Abrams tank, commanded by a black guy, thats protected by the restless spirit of a Confederate Civil War General. And they're related.

*Pic*


Oh no,A mistake has been made  :lol:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 08 Dec 2008, 21:46
Did you guys know the Eiffel Tower is married?

oh dear

Quote
she claims to have a physical relationship with a piece of fence she keeps in her bedroom.

Splinters..

In other news, Liz that is aces!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 08 Dec 2008, 21:59
it could be a metal fence.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 08 Dec 2008, 22:01
Or one of those dinky plastic ones.  Less likely to get Tetanus that way.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 08 Dec 2008, 22:01
Ever seen what happens when you lick a metal pole?

Even worse.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 08 Dec 2008, 22:33
http://www.youtube.com/watch?v=76l3uevQKyA (http://www.youtube.com/watch?v=76l3uevQKyA)

best mst3k episode ever
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 08 Dec 2008, 22:33
Broomrape (http://en.wikipedia.org/wiki/Broomrape) aww yeah
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 08 Dec 2008, 22:36
My initial reaction was "why the fuck does that have it's own Wikipedia article?"

The internet has made me a bad person.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 08 Dec 2008, 22:37
"I know he loves me, he got me some broom rape"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Joseph on 08 Dec 2008, 22:48
i just remember it to 3.14159, I read this autobiography by an HFA fella who had synaesthesia for numbers and letters and words so he would associate shapes and colors for numbers, and because of this words and numbers had individual identities to him, rather than non-connected symbols representing concepts. This caused him to be able to set the record for recitation of Pi decimal places(it was later broken by a jap) and learn Icelandic in a week.

Do you remember the name of this book?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 08 Dec 2008, 23:15
(http://images.encyclopediadramatica.com/images/4/4b/Lesbian-p3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 08 Dec 2008, 23:16
For instructions on how to do it right: see the poster above me.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 08 Dec 2008, 23:57
Do you remember the name of this book?


Born on a Blue Day, by Daniel Tammet


edit (holy shit content): real life stories of mass hysteria (http://webecoist.com/2008/12/06/mass-hysteria/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 09 Dec 2008, 02:05
I have to put this into her back? (http://www.gametrailers.com/player/usermovies/288112.html?playlist=featured)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 09 Dec 2008, 02:22
Thee hee

I would ram it in but my arms arent that strong so i would have use my foot.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 09 Dec 2008, 04:15
(http://img.photobucket.com/albums/v12/sademie/expertdrumstomsawyer.png)

that's how far i got on the first try using just my keyboard. Tom Sawyer - Expert Drums.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gridgm on 09 Dec 2008, 04:42
(http://images.encyclopediadramatica.com/images/4/4b/Lesbian-p3.jpg)

i read this and imagined the horses as lesbians...is that the right way
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 09 Dec 2008, 04:54
sometimes (http://www.sfgate.com/cgi-bin/article.cgi?f=/c/a/2004/02/07/MNG3N4RAV41.DTL)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 09 Dec 2008, 06:40
edit (holy shit content): real life stories of mass hysteria (http://webecoist.com/2008/12/06/mass-hysteria/)


I read through until the dancing plague, and followed through that to the wikipedia article that had possible explanation until I found this...

Quote
Ivan Crozier, a lecturer at the University of Edinburgh and expert on another type of MPI, genital retraction syndrome (or "penis panic"), agrees with Waller's explanation.

Quote
genital retraction syndrome (or "penis panic")

Quote
"penis panic"


Quote from: From Wikipedia
Genital retraction syndrome (GRS), generally considered a culture-specific syndrome, is a condition in which an individual is overcome with the belief that his/her external genitalsor also, in females, breastsare retracting into the body, shrinking, or in some male cases, may be imminently removed or disappear. A penis panic is a mass hysteria event or panic in which males in a population suddenly believe they are suffering from genital retraction syndrome.

Penis panics have occurred around the world, most notably in Africa and Asia. Local beliefs in many instances assert that such syndromes are often fatal.

Quote
OFTEN FATAL

GUYS. WE HAVE A PROBLEM HERE.


Edit: It appears that they actually go on to talk about genital retraction syndrome in the original article linked. they recognize the danger!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 09 Dec 2008, 07:28
They also illustrate that syndrome with screengrabs from the shrinkage episode of Seinfeld. Methinks they are making a subtle statement.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 09 Dec 2008, 10:05
An SNL digital short (http://www.todaysbigthing.com/2008/12/08)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 09 Dec 2008, 10:20
That's a video you should show to a group of your friends and then pay attention to who doesn't laugh.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 09 Dec 2008, 10:23
Hahaha.

As with all of Andy Samberg's work, it's hilarious at first but then gets a little repetitive and grating and ultimately falls short.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 09 Dec 2008, 10:35
Admittedly I know little of his work, since I don't watch SNL every single week, but the couple skits I've seen him in were hilarious through and through:
Mark Wahlberg talks to animals (http://www.dhadm.com/content/snl-mark-wahlberg-animals/)
How to talk to girls (http://celebgalz.com/andy-samberg-snl-dec-6-samberg-9-year-old-advice-video/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 09 Dec 2008, 10:38
Damn im not inside usa (no puns) and it wont show
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 09 Dec 2008, 10:49
All I know is Hot Rod was ace.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 09 Dec 2008, 11:05
Those all kind of sucked. My hatred of SNL and musical humor in general has once again been reaffirmed. Although, I bet it would probably help if I knew what Mark Wahlberg talked like.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 09 Dec 2008, 11:22
For those not in the know, Mark Wahlberg = Marky Mark and the Funky Bunch.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 09 Dec 2008, 12:03
Just crank up the noise and suffer (http://au.youtube.com/watch?v=f-6n0jlN0Eo&eurl=http://www.hilavitkutin.com/videoblogi/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 09 Dec 2008, 12:06
I still say that Andy and the rest of the Lonely Island guys should have their own show.

http://www.thelonelyisland.com/
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 09 Dec 2008, 12:11
(http://newmedia2.funnyjunk.com/pictures/just-do-it-jump.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StMonkey on 09 Dec 2008, 12:12
Just crank up the noise and suffer (http://au.youtube.com/watch?v=f-6n0jlN0Eo&eurl=http://www.hilavitkutin.com/videoblogi/)


I never would have thought alvin and the chipmunks did that sort of advertising
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Clintaga on 09 Dec 2008, 12:43
First of all, for the record, Andy Sambergh's Marky Mark impression is 100% dead on, and I was genuinely impressed with with J***, but their magnum Opus is always going to be, to my mind, Lazy Sunday: http://www.nbc.com/Saturday_Night_Live/video/clips/chronicles-of-narnia-lazy-sunday/2921/ (http://www.nbc.com/Saturday_Night_Live/video/clips/chronicles-of-narnia-lazy-sunday/2921/) (Sorry about the commercial, but I'd rather give you a high quality video link than give you a 'recorded from taping it off my hacked iPhone' link from youtube).
Musical Comedy is definitely one of the most hit/miss brand of comedy, second only to Non sequitur humor (Mitch Hedbergh = Good NS humor, Demtri Martin = Bad NS Humor), but Stephen Lynch is just good, even though he may be a dick in real life, and to be fair, Jack Black has said many times that Tenacious D started out as a just a musical comedy thing, before he realized that they were actually a competent power-rock/soft metal band.

To contribute(http://i297.photobucket.com/albums/mm234/tehTate123/HighSteveBluesClues.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 09 Dec 2008, 12:48
I've never heard anything about Stephen Lynch being a dick. I've met him twice and he was nothing but polite. I even actively seemed to make him feel guilty about one of his songs for a minute.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 09 Dec 2008, 15:21
"he likes you" will always be my favorite sketch with andy sambergh.


A MASTER IS OUT
(http://farm1.static.flickr.com/219/448492229_9aaea435b0.jpg)
(http://farm1.static.flickr.com/175/448494431_84d1ae3dae.jpg)
(http://farm1.static.flickr.com/214/448491588_2531399e5b.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eli on 09 Dec 2008, 16:24
Coffee sketches (http://niemann.blogs.nytimes.com/2008/12/02/coffee/index.html?8dpc)

Wow. Just... wow. (http://weburbanist.com/2008/12/02/papercraft-creative-paper-art-design-sculpture/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 09 Dec 2008, 17:25
My favorite Andy Samberg skit (http://www.nbc.com/Saturday_Night_Live/video/clips/snl-digital-short-andy-punches/166786/)

(http://img380.imageshack.us/img380/5447/chipmunkwalkerlj0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: fozmo on 09 Dec 2008, 17:31
Soulja Boy -- Overrated rapper or poet laureate? You decide.

http://www.youtube.com/watch?v=jtT3SP1D_SY
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 09 Dec 2008, 19:12
(http://carpedenim.files.wordpress.com/2008/07/shamwow.jpg)(http://carpedenim.files.wordpress.com/2008/07/shamwow.jpg)(http://carpedenim.files.wordpress.com/2008/07/shamwow.jpg)(http://carpedenim.files.wordpress.com/2008/07/shamwow.jpg)(http://carpedenim.files.wordpress.com/2008/07/shamwow.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 09 Dec 2008, 19:19
noooooooooooooooo.

For background information, that man was thrown into the advertisement business after an unsuccessful venture (http://www.imdb.com/title/tt0201290/) into comedy... (http://www.ucmovie.com/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 09 Dec 2008, 21:24
HALIFAX HATES YOU (http://uk.youtube.com/watch?v=oz88kJSdT6Y)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 09 Dec 2008, 21:30
lol @ dread hawk
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 09 Dec 2008, 23:32
http://www.youtube.com/watch?v=59KpXaalHno


I cant stop watching this



Warning:dont turn the speakers up to loud or you will die
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 10 Dec 2008, 01:59
(http://www.blastbooks.com/PoH/PoHL.GIF)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 10 Dec 2008, 02:23
Dude O.o wtf?

Thats messed up! I LOVE IT!  :laugh:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Draconis.Wyrm on 10 Dec 2008, 05:18
What is that thing that looks like a microscopic shrimpcrab but is bigger than a cat? It's sorta greypink and has shiny silver eyes and I see it all over the e-nets and it's making me type long run-on sentences.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 10 Dec 2008, 05:35
WAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUGH
(http://ecx.images-amazon.com/images/I/51JKx-oXlhL.%3Cu%3ESS500%3C/u%3E.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Draconis.Wyrm on 10 Dec 2008, 09:28
No, not that thing. This thing. (http://i2.photobucket.com/albums/y43/NapoleontheClown/hiss.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 10 Dec 2008, 09:54
Is it this? (http://www.cinemasterpieces.com/childrenmay08.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 10 Dec 2008, 10:15
Engrish Picture

I love Engrish.com

It's all kinds of unintentional funny.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 10 Dec 2008, 10:21
yes


Sweet what i get? Laid? oh wait im getting hammered so im bound to get laid.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 10 Dec 2008, 10:36
What is that thing that looks like a microscopic shrimpcrab but is bigger than a cat? It's sorta greypink and has shiny silver eyes and I see it all over the e-nets and it's making me type long run-on sentences.

It's a Giant Isopod.

http://en.wikipedia.org/wiki/Giant_isopod
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 10 Dec 2008, 11:38
I have read the giant isopod article like 6 times. Everytime someone links it I read it again.

God damn I'm bored.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 10 Dec 2008, 11:53
I can entertain you. just say word and i will find first thing that come in my mind and post it in here.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 10 Dec 2008, 12:03
Cockthirsty
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 10 Dec 2008, 12:07
(http://images.uncyc.org/commons/0/01/Sabertooth.jpg)
This will do it for long time

(http://www.scifimoviepage.com/upcoming/photos/red_sonja/redsonja-poster.jpg)

(http://upload.wikimedia.org/wikipedia/commons/6/6e/Gray1014.png)

(http://i49.photobucket.com/albums/f299/stumo98/PoD2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 10 Dec 2008, 12:21
That last picture may be the most disgusting thing I have ever seen.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 10 Dec 2008, 12:23
Next please

Edit: now im bored
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mishy on 10 Dec 2008, 14:31
i'm fairly new to the QC forums. hope i don't break any forum rules accidentally...

this is me right now.... (except QC forums, not porn.)
(http://mishtaken.com/hostedfiles/working.png)

this is why....
(http://mishtaken.com/hostedfiles/goofoff.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 10 Dec 2008, 14:37
That's pretty completely untrue. Working in a cubicle was actually one of the easiest jobs I ever had in terms of ease of goofing off, second only to my current job where I don't even have a cube.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 10 Dec 2008, 14:54
When i was pro-sl/ma that was easiest job ever.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mishy on 10 Dec 2008, 15:08
i think this is still the easiest job i've had so far. my co-worker slacks as much as i do and we watch each other's back.
but our new boss has no sense of humour. it should be a requirement for IT.
i came in after lunch yesterday, in a good mood, and i say "hey mike! what's up?"
and he (mike, the boss) says "everything's down!"
and i say "so nothing?"
he didn't laugh.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 10 Dec 2008, 16:31
Michy I read your post and thought you were Ladybug because you two have the same avatar.  It was confusing for a moment.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 10 Dec 2008, 19:58
*buncha pictures of church sign argument...*

DOGS DO NOT GO TO HEAVEN, THIS IS NOT OPEN FOR DEBATE
Note that the Presbyterian Church in the series is a Cumberland, not a PC(USA).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 10 Dec 2008, 20:49
(http://newmedia2.funnyjunk.com/pictures/ifcolumbushadgooglemaps.jpg)
(http://newmedia2.funnyjunk.com/pictures/weddingcakewar_700.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: allison on 10 Dec 2008, 21:20
HALIFAX HATES YOU (http://uk.youtube.com/watch?v=oz88kJSdT6Y)

Picnicface. It's why Canada is awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 10 Dec 2008, 22:58
Me and Kat went to Goodwill to get some vinyl records for fun and we got some doozys. These are our favorite finds.

Oh the 60's.. and seriously what the hell is up with that name.

(http://img.photobucket.com/albums/v619/ackblom12/STA72151.jpg)

Alan McGill.... child molester

(http://img.photobucket.com/albums/v619/ackblom12/STA72157.jpg)

And this one is just fucking awesome. I still need to actually go over to Kat's parent's house to listen to it.

(http://img.photobucket.com/albums/v619/ackblom12/STA72161.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 10 Dec 2008, 23:07
Your mom's mom probably thought Engelbert Humperdinck was the shit.

And yes, people used to dress like that, and that's his real hair...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 10 Dec 2008, 23:31
(http://msp210.photobucket.com/albums/bb247/atomicmouse/stay_classy.gif)

I want my soul back (http://awesomepants.com/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 10 Dec 2008, 23:54
(http://i186.photobucket.com/albums/x59/LouBriccant/vqhhyrpfxo1dp37bybcq.gif)

Also: What teh grrlz are saying about teh Hasselhoff...

(http://i186.photobucket.com/albums/x59/LouBriccant/littlepenis.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 11 Dec 2008, 00:48
Man Engelbert Humperdinck is still the shit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 11 Dec 2008, 01:01
Engelbert Humperdinck is a vampire! nowdays his name is Jemaine Clement, they are the same person but he dont fool me with his glasses, no sirrree
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 11 Dec 2008, 01:12
WHAT IS BROWN AND RHYMES WITH SNOOP?

DR. DRE

(http://blogs.nypost.com/popwrap/photos/Statler_Waldorf.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 11 Dec 2008, 01:59
When i get rich i will buy castle and have most awesome parties (http://www.castles-for-sale.com/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 11 Dec 2008, 06:46
they have a fucking castle built in the 13th century by the Knights Templar...


fuuuuck
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 11 Dec 2008, 07:21
I'm buying in right fucking now
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 11 Dec 2008, 07:31
(http://img.photobucket.com/albums/v12/sademie/1228774545071.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 11 Dec 2008, 09:31
Hilarious.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 11 Dec 2008, 09:56
Please explain this joke
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 11 Dec 2008, 10:35
Go to the Books & Movies subforum and look at the Twilight thread.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 11 Dec 2008, 10:44
Rick Roll UK Christmas Charts (http://www.ultimaterickroll.com/)

My name is John McCain, and I approve of this message.

I'm not really John McCain, see I just said that to get your attention. John McCain doesn't really approve of this message. I mean, he might, but I don't know. I don't even know if he knows about it, but I think he would approve if he did know.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 11 Dec 2008, 16:45
(http://img296.imageshack.us/img296/8130/scorpionsarejerkstt9.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eli on 11 Dec 2008, 17:03
Calvin and Hobbes snowmen (http://img293.imageshack.us/img293/8866/calvinsnowartsv1.png)

Man, I love those comics.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 11 Dec 2008, 21:25
(http://newmedia2.funnyjunk.com/pictures/catcarrier.jpg)
This makes a great Xmas gift for your cat.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 11 Dec 2008, 23:01
(http://img392.imageshack.us/img392/6715/robinintheryexe9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 12 Dec 2008, 01:06
Wow.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 12 Dec 2008, 01:19
Fuck yeah

I'm a scorpion and im a real asshole!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 12 Dec 2008, 05:57
(http://bunkstrutts.files.wordpress.com/2007/08/batmobile-babe-magnet.jpg)


NO
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 12 Dec 2008, 07:39
YES
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 12 Dec 2008, 08:24
CHANGE IS TAKING THE SEVENTH DICK! THIS ONE'S FOR YOU J0N!

(http://s10.photobucket.com/albums/a127/r3an1m4t3d/change.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 12 Dec 2008, 12:40
(http://punditkitchen.files.wordpress.com/2008/12/political-pictures-ukranian-army.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 12 Dec 2008, 13:21
Looks like Flo from the Progressive commercials ...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 13 Dec 2008, 00:12
(http://fukung.net/images/2370/jamie_disapproves.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 13 Dec 2008, 00:16
Thread over.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 13 Dec 2008, 11:37
Fuck NO

(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/HP5562Cat.jpg)
Cat says so

(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/19383.jpg)

Lets get pointless ladies

(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/that-is-not-the-fantasy.gif)
(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/tiny-harlot.gif)

Take this you Jamie


But ultima mode i shall save you


(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/skgi_2134587_17985.jpg)
(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/20080324-Chikyu_Boeigun_poster.jpg)

Must go to basic form
(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/100-0070_IMG_retouch.jpg)
Please just water me and i'l be fine
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 13 Dec 2008, 12:58
Looks like Flo from the Progressive commercials ...

I'm going to have a forever erection.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 13 Dec 2008, 13:54
Hey, guys, I found something.

(http://www.eegra.com/comics/2008/12/67.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cernunnos on 13 Dec 2008, 17:05
This guitar has a telephone (http://www.youtube.com/watch?v=1O2eKIOIyBI)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 13 Dec 2008, 17:52
Quote
Spank it to animated GIF of Phoenix Wrigh [character]

Everyone who is anyone does this
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 13 Dec 2008, 21:44
Frosty the Coalman (http://www.youtube.com/watch?v=N3q6HeImpPs)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 14 Dec 2008, 00:41
Everybody knows the Israeli army is where it is at

(http://airbornecombatengineer.typepad.com/photos/mideast/idfgirl.jpg)

(http://i11.photobucket.com/albums/a157/pumix/IsraeliMilitaryGirls.jpg)

(http://static.flickr.com/66/206324080_a3a6af9506_o.jpg)

(http://farm3.static.flickr.com/2067/2091832878_e6d24e2a2a.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 14 Dec 2008, 02:32
I deleted the original post at the top of this page because it's starting to get ridiculous.

This is the Pointless Thread, not the sexy ladies in army uniform thread.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 14 Dec 2008, 02:43
(http://i95.photobucket.com/albums/l157/Pianogirl23/CompleteandUtterRandomnessSign.jpg)

(http://i5.photobucket.com/albums/y189/shawnlevy/web.jpg)

(http://canuckgamer.com/__oneclick_uploads/2007/12/m2.jpg)

(http://media.ebaumsworld.com/picture/failerb/motivator9571935.jpg)

(http://www.youllshitbricks.com/wutimg/gp6g7qrkw7soi49cb8mh2971434f82sv2.jpg)

(http://stereogum.com/img/neil_young-bubblegum_card.jpg)

Better?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 14 Dec 2008, 02:49
We're not too fond of the stupid fake demotivators either, but at least it's not inching toward porn.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gridgm on 14 Dec 2008, 04:22
i'd also recomend no hotlinking to other sites if you think it's that funny go to the effort of uploading it to photo bucket or the like
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eli on 14 Dec 2008, 06:05
(http://i8.photobucket.com/albums/a10/funkigurl/1201577867419605.jpg)

(http://i8.photobucket.com/albums/a10/funkigurl/Hopper-1.jpg)

(http://i8.photobucket.com/albums/a10/funkigurl/dibert.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 14 Dec 2008, 09:38
(http://www.airdeparis.com/jfp/drawings/2005/1524.2005.gif)

(http://www.picturesofwalls.com/Database/Filestore/withoutlove.jpeg)

(http://i236.photobucket.com/albums/ff100/imagercc1/archive/page6/chucknorrisactionjeans_700.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Spike on 14 Dec 2008, 18:03
http://www.youtube.com/watch?v=5OxNooekR3A (http://www.youtube.com/watch?v=5OxNooekR3A)

Would this be like when Jimmy Carter was attacked by a rabbit?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 14 Dec 2008, 21:19
Excellent reflexes my young padawan.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gilead on 14 Dec 2008, 21:22
http://uk.youtube.com/watch?v=smJskrMZXAU

OCEAN SHARK.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 14 Dec 2008, 21:41
good show, sir.

Is there a sequel?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gilead on 14 Dec 2008, 21:42
Not yet.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 14 Dec 2008, 21:47
(http://newmedia2.funnyjunk.com/pictures/this-sign-has-sharp-edges.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Allybee on 14 Dec 2008, 21:55
(http://jemts.com/dori/wp-content/uploads/2007/12/wood.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 14 Dec 2008, 21:59
I do not need no tools to identify wood.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 14 Dec 2008, 23:01
I do not need no tools to identify wood.


 :lol: heh heh i bet
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 15 Dec 2008, 03:18
Shark in roof

I live round the corner from that shark (yes, it's real, not faked).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 15 Dec 2008, 04:17
Shark in roof

I live round the corner from that shark (yes, it's real, not faked).


Did you ever touch it? if so whats it feel like?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pwhodges on 15 Dec 2008, 06:11
Only in the dead of a starless night so that no-one could catch a picture of me doing it.



It's fibreglass, BTW.  More details here (http://www.headington.org.uk/shark/), including the planning arguments.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 15 Dec 2008, 06:56
(http://img296.imageshack.us/img296/6121/kitemanla6.jpg)

(http://img125.imageshack.us/img125/3442/ewokfightuw9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Emaline on 15 Dec 2008, 06:57
(http://sharp edges.)


It really bothers me that that sign does not have sharp edges.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 15 Dec 2008, 07:44
http://uk.youtube.com/watch?v=smJskrMZXAU

OCEAN SHARK.

That is pretty great. What's that song at the end? I'm sure I've heard it in some move before?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cernunnos on 15 Dec 2008, 07:52
wood

looks like red cedar maybe
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 15 Dec 2008, 11:48
That wood picture has been posted at least twice before.

It's still great.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: allison on 15 Dec 2008, 12:22
(http://i35.photobucket.com/albums/d158/dream_loud/258mpz9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cernunnos on 15 Dec 2008, 12:30
aaaand that's why i don't watch television
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 15 Dec 2008, 12:52
Oh man where is that from?  I recognize the animation, but I don't know the name.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 15 Dec 2008, 12:57
Scott McCloud?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 15 Dec 2008, 13:23
aaaand that's why i don't watch television
the internet is much better anyway.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 15 Dec 2008, 15:39
(http://img.timeinc.net/time/today_in_pictures/0812/tip_ny_1204_02.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Thomas Edison on 15 Dec 2008, 15:57
And that will be turned into a demotivator in three, two, one...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 15 Dec 2008, 17:04
YEP, IT'S WOOD

uh.  Man, I made the exact same joke on the original image a few pages back (a dozen pages mebbe?) I guess I am just wondering if someone has come up with the same thing or if someone from here photoshopped the image I posted with what I said.  Odd!

(I mean, my thing wasn't entirely original or unique so I guess it wouldn't be a big co-incidence or anything, just curious)

edit: I've found references to that image from early January this year and I only saw the raw image in August, so it's definitely a co-incidence!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 15 Dec 2008, 19:23
Apparently, a whole bunch of new species have been photographed and catalogued.


For example, check this majestic creature:
(http://i12.photobucket.com/albums/a207/Xyljin/woolly-bat_1206264i.jpg)


Or this guy:
(http://i12.photobucket.com/albums/a207/Xyljin/Fuckingawesome.jpg)


I don't know why they are so furry, but I approve.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 15 Dec 2008, 19:40
Those are some cool mother fucking mammals.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 15 Dec 2008, 19:48
Dude needs a razor for Christmas.

I wanted to post the Alan Moore comic again, but I can't seem to find it.  So here's this for the holiday season.

(http://img296.imageshack.us/img296/5729/behindyoutj1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Elk on 15 Dec 2008, 19:53
(http://i12.photobucket.com/albums/a217/youaremykilikiller/shark.jpg)

(http://www.smh.com.au/ffximage/2005/02/06/oarfish430_wideweb__430x242.jpg)

(http://www.islasanmarcos.com/oarfish93.jpg)

(http://www.mexfish.com/fish/oarfish/oarfish.jpg)

(http://upload.wikimedia.org/wikipedia/commons/thumb/a/a3/Soe_Orm_1555.jpg/800px-Soe_Orm_1555.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 15 Dec 2008, 21:34
I don't know why they are so furry, but I approve.

http://www.jaynaylor.com/betterdays/archives/2003/04/post-2.html
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 15 Dec 2008, 21:41
nooooooooooooooooooo
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Elk on 15 Dec 2008, 21:59
I clicked the link...


and I was all like

(http://www.lexingtoncollection.com/images/shocked_face.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 16 Dec 2008, 08:17
ahahahaha

fuck youuuuu ballard, i am going to get sucked in again!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: supersheep on 16 Dec 2008, 09:22
http://www.jaynaylor.com/betterdays/archives/2003/04/post-2.html
It's not the anthropomorphised animals having sex that I find offensive here, but the ridiculous political opinions the author has his characters voice. Incest? Pshaw. Insano-conservatism can fuck off.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 16 Dec 2008, 09:43
Oh eww.  The pig foreskins was the worst part.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 16 Dec 2008, 10:22
Oh man dude, not just incest, but twincest. That's a special level of squick right there.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Slick on 16 Dec 2008, 11:40
jesus christ I'm glad I stopped reading before the twincest
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Elk on 16 Dec 2008, 12:13
I have this problem where when I start a web-comic, no matter how terrible it is, I can not stop reading.

10 Year old furry sex.

That is how far I got.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: IronOxide on 16 Dec 2008, 12:26
Trust me, it gets actually worse once the 10 year old furry twincest ends. He becomes a secret agent or some shit and goes on a private quest to save his sex slave junkie ex-model cousin.

I wish I could be making this up
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 16 Dec 2008, 12:27
It really bothers me that that sign does not have sharp edges.

Sure it does! Sharp corners it does not have.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 16 Dec 2008, 12:38
A guy in my high school advisory was obsessed with that comic. He brought naked pictures fan-art of the girl skunk character to school, like, everyday. And just..stared at them. And wrote erotic fan-fiction. And, ew.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Slick on 16 Dec 2008, 13:01
Trust me, it gets actually worse once the 10 year old furry twincest ends. He becomes a secret agent or some shit and goes on a private quest to save his sex slave junkie ex-model cousin.

It is like a train-wreck and I can not look away and the train is about to run over my face shit shit shit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Slick on 16 Dec 2008, 13:39
The toyota prius is not (http://ca.youtube.com/watch?v=gsJjZIuF1lg) bulletproof.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 16 Dec 2008, 13:46
A guy in my high school advisory was obsessed with that comic. He brought naked pictures fan-art of the girl skunk character to school, like, everyday. And just..stared at them. And wrote erotic fan-fiction. And, ew.


Man, I was born a few crucial years too soon. My deep love of video games and the fact that I once admitted to liking the Wrath of Khan marked me as a hopelessly deviant nerd in my highschool. If I had just one classmate who was into furries (or hell, if any of us had any idea what furries were), minds would have been blown and nobody would ever have talked shit about my caffeine molecule t-shirt ever again.


[EDIT]

P.S.
Man, I didn't know anything about Better Days or this Jay Naylor guy before that link. I ended up googling the guy and finding out that he's conservative Objectivist who draws furries. Now I have to spend the rest of my evening feeling awkward just for knowing such a guy exists.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 16 Dec 2008, 13:55
(http://img186.imageshack.us/img186/7043/chubbymarylq2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dazed on 16 Dec 2008, 14:04
wow that was depressing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Reed on 16 Dec 2008, 14:13
I've always been a fan of Top Gear's trip (http://ca.youtube.com/watch?v=DOyDLUzAAOY) to Alabama (http://ca.youtube.com/watch?v=2syY12OPkwI)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 16 Dec 2008, 14:51
wow that was so awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 16 Dec 2008, 15:22
When did awesome and depressing become SYNOMYMS?

EDIT: oh wow. silly.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 16 Dec 2008, 15:24
When did simile and synonym become similes?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 16 Dec 2008, 15:32
here is a movie trailer in which gary busey plays an evil gingerbread man to balance out all the sad (http://www.youtube.com/watch?v=G2065epgY2E)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Reed on 16 Dec 2008, 15:42
The gingerdead man can fire a gun!! HE'S UNSTOPPABLE!!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 16 Dec 2008, 15:50
NO, SADNESS REIGNS SUPREME!

(http://img206.imageshack.us/img206/2687/strongge0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 16 Dec 2008, 17:03
jesus
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 16 Dec 2008, 17:05
I've always been a fan of Top Gear's trip (http://ca.youtube.com/watch?v=DOyDLUzAAOY) to Alabama (http://ca.youtube.com/watch?v=2syY12OPkwI)
Thank GOD we now know what the entire fucking state thinks about every fucking thing!

Idiots.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 16 Dec 2008, 17:07
actual garfield strips from october 1989 -

(http://img339.imageshack.us/img339/7798/garfield1ks0.jpg)
(http://img339.imageshack.us/img339/5871/garfield2aw0.jpg)
(http://img339.imageshack.us/img339/1037/garfield3ar1.jpg)
(http://img296.imageshack.us/img296/9269/garfield4hk1.jpg)
(http://img296.imageshack.us/img296/3046/garfield5to1.jpg)
(http://img224.imageshack.us/img224/1184/garfield6qr6.jpg)

YOU HAVE NO IDEA HOW ALONE YOU ARE, GARFIELD
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 16 Dec 2008, 17:08
I remember that strip!! It never failed to scare the shit out of me.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 16 Dec 2008, 19:48
FOUND IT, SADNESS OVER!!

(http://img72.imageshack.us/img72/1481/alanmoore1rv5.jpg)
(http://img72.imageshack.us/img72/9529/alanmoore2cf1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 16 Dec 2008, 21:37
Consider my day made.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dazed on 16 Dec 2008, 21:40
Man I wish Alan Moore would read my fortune.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 17 Dec 2008, 09:43
(http://img.photobucket.com/albums/v12/sademie/coolface.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wolf on 17 Dec 2008, 14:30
I think this site is going to take the internets by storm.
http://www.cutethingsfallingasleep.org/



I like the bear
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: bicostp on 17 Dec 2008, 15:46
This is why you should always have a camera close by when you watch The Weather Channel:

(http://img291.imageshack.us/img291/7573/whoopsdc3.jpg)

Save $150,000 on brand-new 2008 F150s?! Sign me up!

Earlier at the store, there was a sign advertising a sale: "WAS $19.99 NOW $19.98 SAVE 0%!"
The one time I wish my phone had a camera...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 17 Dec 2008, 21:12
FOUND IT, SADNESS OVER!!
ALAN MOORE ADVENtURES

Bonus! The little boy looks like Pinnochio from Fables.
Also:
 
http://www.cutethingsfallingasleep.org/

WHY HAVE YOU DONE THIS TO ME IT WILL CONSUME MY LIFE
THE CUTE IS TOO MUCH
SOON IT WILL BE WEAPONIZED
THOSE CRAZY BASTARDS DON'T KNOW WHAT MONUMENTAL FORCES THEY ARE TOYING WITH
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 17 Dec 2008, 21:13
It's drawn by the guy that does Fables, Alan looks exactly like Thrushbeard.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 17 Dec 2008, 21:17
Oooo, didn't make the Thrushbeard connection.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 17 Dec 2008, 22:40
Seems appropriate

(http://img355.imageshack.us/img355/3391/warrenellisgj9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 18 Dec 2008, 00:07
Seems appropriate

*Pic*


Wut  :?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 18 Dec 2008, 04:53
HE'S WARREN BLOODY ELLIS YOU BOLLOCKS
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 18 Dec 2008, 14:28
(http://img161.imageshack.us/img161/948/dpjpgin4.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 18 Dec 2008, 14:30
Ah, now it's all clear.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 18 Dec 2008, 14:40
(http://www.dslextreme.com/users/markpoyser/images/imclone00.gif)

(http://www.brunching.com/images/geekchartbig.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 18 Dec 2008, 14:47
(http://newmedia2.funnyjunk.com/pictures/class_is_cancelled.jpg)

@mberan42 Ahh my eyeeeeesssss, sooooo much text
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Elk on 19 Dec 2008, 00:13
(http://truckbearingkibble.com/images/comic/12-08-08.jpg)
(http://truckbearingkibble.com/images/comic/06-08-07.jpg)
(http://truckbearingkibble.com/images/comic/07-06-07.jpg)
(http://truckbearingkibble.com/images/comic/04-13-07.jpg)


(http://truckbearingkibble.com/images/comic/01-28-08.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 19 Dec 2008, 01:25
What the hell?  :-o


Where did you find those?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 19 Dec 2008, 01:48
TRUCKBEARINGKIBBLE.COM

it's on three of the comics, for christ's sake.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 19 Dec 2008, 02:07
TRUCKBEARINGKIBBLE.COM

it's on three of the comics, for christ's sake.


Oh...Right    :oops:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dollface on 19 Dec 2008, 05:47
(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/creepy_ewok.gif)

(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/keiju.jpg)

(http://i256.photobucket.com/albums/hh191/Wondersaunahotpants/macduffyads.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 19 Dec 2008, 06:29
*Top Pic*


What the hell is THAT?  :-o
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 19 Dec 2008, 06:50
An Ewok...cuddling a blond child...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 19 Dec 2008, 07:25
don't you believe in fairies?

See now this is a classic example of, what was the point of turning this into a demotivator? The caption merely repeats the dialogue in the comic.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 19 Dec 2008, 07:41
An Ewok...cuddling a blond child...

Warwick Davis  (http://www.imdb.com/name/nm0001116/)in an Ewok costume cuddling a blond child in fact.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 19 Dec 2008, 07:44
God, that movie is so fucking terrible.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 19 Dec 2008, 09:02
http://www.youtube.com/watch?v=A9k4SVl5pBs (http://www.youtube.com/watch?v=A9k4SVl5pBs)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 19 Dec 2008, 09:52
(http://img380.imageshack.us/img380/1417/slyt9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 19 Dec 2008, 11:29
oh my
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 19 Dec 2008, 18:51
i've been looking for this since rotten.com was forced to take it down.

a real treasure of the internet.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Elk on 19 Dec 2008, 22:04
(http://img520.imageshack.us/img520/5310/sciencekd1.png)
(http://img520.imageshack.us/img520/2338/science2kr7.jpg)
(http://img503.imageshack.us/img503/535/science3nz4.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 19 Dec 2008, 22:14
man i am not a fan of those ripoff graphics.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 20 Dec 2008, 16:59
tommy, you're a fan of these sorts of headlines right?

http://gizmodo.com/5047183/giant-freezer-can-hold-fighter-jets-megatron
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 20 Dec 2008, 19:27
be careful with those, it's a slippery slope

(http://penny-arcade.smugmug.com/photos/434317751_3vcmi-M.jpg)

and now for something else
(http://img72.imageshack.us/img72/889/whooshvn0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 20 Dec 2008, 20:53
be careful with those, it's a slippery slope

wut?

(http://penny-arcade.com/uploads/2008/12/05/dickerdoodles1.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_1.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_4.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_6.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_10.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_14.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_8.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_11.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_15.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_16.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_2.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_7.jpg)
(http://www.penny-arcade.com/dickerdoodles/dd_12.jpg)
(http://farm3.static.flickr.com/2244/2134068181_50c3e7eee4.jpg?v=0)
(http://farm4.static.flickr.com/3244/3091682236_4c63380012.jpg?v=0)
oh, and this one (http://kaneda435.deviantart.com/art/Dickerdoodle-105753481)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 20 Dec 2008, 21:30
I feel like making a Gingerbread man joke.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 20 Dec 2008, 21:47
(http://i80.photobucket.com/albums/j191/Reamerer/drivewhileyoudrive.jpg)

(http://i80.photobucket.com/albums/j191/Reamerer/derivewhileyouderive.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 20 Dec 2008, 21:58
Oh god Joe my sides.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: StaedlerMars on 20 Dec 2008, 22:17
www.youtube.com/watch?v=skCV2L0c6K0

NoWay!

GetReal!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 21 Dec 2008, 00:13
(http://i186.photobucket.com/albums/x59/LouBriccant/Pokeball_GO_by_guruji.gif)
(http://i186.photobucket.com/albums/x59/LouBriccant/eyes-1.gif)
(http://i186.photobucket.com/albums/x59/LouBriccant/iraqimage008jk3.gif)
(http://i186.photobucket.com/albums/x59/LouBriccant/1229398517645.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Draconis.Wyrm on 21 Dec 2008, 00:37
(http://i38.tinypic.com/juz953.jpeg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 21 Dec 2008, 02:33
http://funnyjunk.com/movies/1638/Malfunctioning+Dog/

http://www.funnyjunk.com/movies/826/Annoying+Chick/


These two made my day.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Puki on 21 Dec 2008, 02:36
http://funnyjunk.com/movies/1638/Malfunctioning+Dog/

Ok, wtf is wrong here?
Nevermind, I've read the comments. Actually quite bizzare.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 21 Dec 2008, 11:13
Notice how cool that guy in the chick video is with his semi-fauxhawk. 

so hip
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 21 Dec 2008, 13:04
I find these videos captivating and I'm not sure why:
http://www.youtube.com/watch?v=JhVRL9q8bis

There's just something brilliant about the concept of an airhead with a really thick accent explaining the etymology of English words.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 21 Dec 2008, 23:33
(http://www.nastyhobbit.org/forum/animated_gifs/disturbing.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 22 Dec 2008, 11:47
Is that from Metropolis?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 22 Dec 2008, 15:28
(http://i208.photobucket.com/albums/bb56/david_h_c/2469085160_39c20f4b93_b.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CardinalFang on 22 Dec 2008, 16:59
(http://i37.photobucket.com/albums/e74/flemco/mt4hw2thumbnail.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CardinalFang on 22 Dec 2008, 17:07
Don't worry it isn't me.

If it were me you wouldn't have been able to either see well enough to type nor have the sanity left to be coherent.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: CardinalFang on 22 Dec 2008, 17:12
(http://i158.photobucket.com/albums/t85/FangHamhands/1008.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wolf on 22 Dec 2008, 17:41
I heard this is a real commercial in Canada.  I hope so.

http://www.youtube.com/watch?v=dyyNDG9FMgY
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 22 Dec 2008, 18:19
Unfortunately, I know this (http://www.youtube.com/watch?v=noFCekWiUGE) is an actual Canadian PSA.

Canada does not fuck around when it comes to soup safety.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wolf on 22 Dec 2008, 18:53
After watching that I will stick to my crack cocaine and unprotected sex. working in a kitchen looks scary.

ps Merry Christmas.

(http://post.thestranger.com/images/blogimages/2008/12/22/1229988021_ginger-1.jpg)

gingerbread AT-AT Walker.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Yakob on 22 Dec 2008, 19:03
Canada does not fuck around when it comes to soup safety.

Do I have enough forum cred to sigquote? I sure hope so.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 22 Dec 2008, 19:06
(http://i209.photobucket.com/albums/bb155/Pilomotor/40c50b25690bac420bbd7e30a933c89c.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 22 Dec 2008, 19:31
(http://newmedia2.funnyjunk.com/pictures/pointsofview.jpg)
(http://newmedia2.funnyjunk.com/pictures/girls-tshirt__5__thumb.jpg)
(http://newmedia2.funnyjunk.com/pictures/japan.jpg)
(http://newmedia2.funnyjunk.com/pictures/michael_phelps.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 22 Dec 2008, 19:33
Here are some more prevent-it adds. (http://au.youtube.com/watch?v=MwCyVku1HvI&feature=related) Man, serious business.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Reed on 22 Dec 2008, 20:04
I like how in each one they make sure that the dead person is still partially at fault....way to support those workers!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 22 Dec 2008, 21:45
(http://img386.imageshack.us/img386/683/whatisgoingonbv2.jpg)

Also, this (http://community.livejournal.com/scans_daily/5862568.html).  A weird comic from Bruce Timm, brought to you but our own Gargoyle Kitty.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 22 Dec 2008, 23:59
Cant decide if that pic is more messed up than the comic...



Hmm...Tough choice



also whats that guy doing with that dog anyway?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 23 Dec 2008, 00:11
Actually, Joe Lansdale is to blame; Timms just did the art.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 23 Dec 2008, 06:10
That comic was awesome.


Agreed

The whole thing was messed up but was great to read,the ending threw me off though.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 23 Dec 2008, 12:07
wow (http://www.youtube.com/watch?v=XsH9eKW0u-g&eurl=http://www.dlisted.com/&feature=player_embedded)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: KickThatBathProf on 23 Dec 2008, 12:12
oh you conservative christians
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 23 Dec 2008, 16:58
(http://img214.imageshack.us/img214/460/mykittyscreamsln4.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 23 Dec 2008, 17:30
(http://i61.photobucket.com/albums/h65/Damagepoon/16.jpg)

(http://images.amazon.com/images/P/B00005QVZ0.01.LZZZZZZZ.jpg)

(http://mischalke04.files.wordpress.com/2008/03/frauleins-in-uniform.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 23 Dec 2008, 18:24
(http://cdn.thesuperficial.com//bfm_gallery/2008/12/1222%20Superficial%20News/post_image/post_image-1222_superficial_news_00.JPG)

Look on my president, ye mighty, and despair.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 23 Dec 2008, 18:54
BTW, Silent Rage is easily one of the most ridiculously bad movies ever, and I deeply apologize if I have neglected to mention it in the Terrible Movies Thread. It needs to be seen to be believed.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 23 Dec 2008, 19:04
Man, Silent Rage is an amazingly entertaining terrible movie.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 23 Dec 2008, 19:14
To me, that movie is the film equivalent of Rush. I'm not really in a hurry to sit through it again, but making jokes about it has enriched my life on so many levels that I cannot help but feel affection towards it. It has one of those special kind of plots where you know exactly what is going to happen even as rational thought rebels against the realization.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 23 Dec 2008, 19:15
wow (http://www.youtube.com/watch?v=XsH9eKW0u-g&eurl=http://www.dlisted.com/&feature=player_embedded)

Ooh! I found these videos (http://www.youtube.com/watch?v=BS5vid4GkEY&feature=related) searching for venomfangx's ridiculous creationist videos. They're really interesting, educational, and amusing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ZJGent on 23 Dec 2008, 23:41
Merry Communist Christmas (http://rathergood.com/christmas).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 24 Dec 2008, 03:19
I only found the lyrics and the last joke funny.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 24 Dec 2008, 04:02
(http://cdn.thesuperficial.com//bfm_gallery/2008/12/1222%20Superficial%20News/post_image/post_image-1222_superficial_news_00.JPG)

Look on my president, ye mighty, and despair.
I, for one, am glad to have a president that's ripped.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 24 Dec 2008, 10:28
(http://looku.com/imagebin/full/1226827186Nick704.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 24 Dec 2008, 10:41
What the hell...


 :laugh:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: WriterofAllWrongs on 24 Dec 2008, 10:44
Enter internet a bloo bloo bloos.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 24 Dec 2008, 12:47
The first major asbestos mine was in Quebec, the Appalachian foothills I think, it'd been in operation since the late 19th C. Even by the time that advertisement was published, there was enough evidence that asbestos fibres have massive adverse effects on the human condition, i.e. pneumoconiosis, mesothelioma and lung cancer among other things. The vast majority of such asbestos related illnesses were obviously in the working class of which there are many and work is cheap.

I'm ranting, aren't I
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 24 Dec 2008, 12:48
They still use asbestos in Canada?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 24 Dec 2008, 13:03
Last I heard, only Russia exports more asbestos than Canada. At one point France banned the stuff for health reasons which led to Canada raising a stink and the WTO getting involved since they claimed that such a ban hurt free trade.

I dunno though, I haven't really read much about the subject since the late '90s/early '00s.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: pen on 24 Dec 2008, 13:51
My dad sent this to me... it's kinda sad.

http://www.youtube.com/watch?v=lC9ftIE8XRQ
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 24 Dec 2008, 14:14
They still use asbestos in Canada?

Still mine, it usually goes off to Asian countries.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 24 Dec 2008, 14:34
Oh hey, fun fact. My school still has asbestos in it.

And now for this. (http://www.youtube.com/watch?v=3xruJ10C19U)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 24 Dec 2008, 14:41
(http://newmedia2.funnyjunk.com/pictures/da829b9944429bf4656f6cd238411efb7c538dff_m.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 24 Dec 2008, 23:08
My sister's boyfriend has that on a shirt. It amuses me that she is dating someone so much like me.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 25 Dec 2008, 05:08
We're all glad you are amused at incest-by-proxy.

It is funny. :wink:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 25 Dec 2008, 06:30
Well c'mon, the only thing more typical is a girl dating someone like her dad. ha ha

...

Actually, come to think of it, he has a lot in common with my dad too. The things he has in common with me are largely things I have in common with my dad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 25 Dec 2008, 10:07
  ▲
▲ ▲
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 25 Dec 2008, 12:14
Yeah, I think many of us have seen the same kind of thing happen. My sister used to have a huge crush on my best friend up until she found her current guy, and obviously my friend and I get along so well in part because we share a lot of the same traits and values, so I always found it kind of funny.
 
Also, one of the funniest things about growing up with my best friend was the fact that many of his friends thought his sister was really hot. The hilarious bit is that there is a really, really strong family resemblance between the two, and they looked even more alike before puberty. To this day, I cannot help but think that his sister looks just like him, except with longer hair and boobs tacked on, so it hits me as kind of funny when guys drool over her. He doesn't find it quite so amusing, for obvious reasons.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 25 Dec 2008, 13:39
I just want to say that I am so glad that I have nothing in common with my brothers-in-law.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Bowers on 26 Dec 2008, 06:16
http://www.stickpage.com/castle.shtml (http://www.stickpage.com/castle.shtml)

Watch the bottom one first  :-D
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 26 Dec 2008, 19:36
(http://www.chrisyates.net/reprographics/comics/112thepostaldisservice.jpg)


NWS (http://img.photobucket.com/albums/v12/sademie/spiderWHAT.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 26 Dec 2008, 20:13
silly mr. yates
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 26 Dec 2008, 20:39
(http://img267.imageshack.us/img267/7042/bubastasrd2.png)

(http://img267.imageshack.us/img267/6089/captainamericagg3.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 27 Dec 2008, 06:51
.......What the hell?



Dare i ask,why someone would make that?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Elk on 27 Dec 2008, 08:21
Because it is funny.

HA HA HA HA HA.


Ediit:

(http://content.funnyhumor.com/pictures/punkkid.jpg)
(http://www.notempire.com/images/uploads/beads%20tee.jpg)
(http://farm4.static.flickr.com/3140/2283912281_8ac221770a.jpg?v=0)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 27 Dec 2008, 11:51
(http://i101.photobucket.com/albums/m59/jt9669/Silly/43.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 27 Dec 2008, 13:36
(http://emmy.eviltrailmix.com/Lizzy/Lizzy15.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 27 Dec 2008, 14:21
The whole comic strip isn't half-bad.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 27 Dec 2008, 17:01
(http://img267.imageshack.us/img267/6089/captainamericagg3.jpg)

Do you know if this is something that was done with Kate Beaton's knowledge or wot wot wot
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 27 Dec 2008, 18:16
It's a pretty dang good imitation of her style
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 28 Dec 2008, 00:05
Yeah, it is a frame by frame (I think) reproduction of a comic about Mr Darcy.  Just wondering if someone did it for her on her LJ or if it's someone ripping her off or wot.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tommydski on 28 Dec 2008, 01:38
I think that was the point maybe?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 28 Dec 2008, 02:36
Yeah probably
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: DonInKansas on 28 Dec 2008, 06:23
That's not a centaur. :-D
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Christophe on 28 Dec 2008, 08:11
Here is an Obama Dildo (http://www.warrenellis.com/?p=6621) if you ever wanted our new commander-in-chief to give you orgasms.

Yes We Cunt!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 28 Dec 2008, 09:14
That's not a centaur. :-D


well it's a reverse-centaur... i think the guy understands that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 28 Dec 2008, 16:55
(http://img134.imageshack.us/img134/832/palinflagbikinikw9.png)

(http://www.funnyexamanswers.com/img/shesawoman.jpg)

(http://i127.photobucket.com/albums/p138/TrickyZ33/Funny%20Pics/gay-heman.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 28 Dec 2008, 16:59
Here is an Obama Dildo (http://www.warrenellis.com/?p=6621) if you ever wanted our new commander-in-chief to give you orgasms.

Yes We Cunt!

Sweet Jesus!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 28 Dec 2008, 23:12
Don't you just love capitalism?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: look out! Ninjas! on 28 Dec 2008, 23:16
Not as much as I now love Democracy.

Huge, throbbing Democracy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 28 Dec 2008, 23:20
I am not a scholar of the female anatomy but Obama does not look very comfortable.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 29 Dec 2008, 01:55
On the contrary, there's a huge Obama-shaped hole in every woman in America.
And now we know where it is.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 29 Dec 2008, 08:32
Flirting with Magic (http://www.youtube.com/watch?v=98YfDn-Afpg&feature=related).

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Josefbugman on 29 Dec 2008, 14:22
*cough* erm, sorry about this chaps, I know I am a new bug and all that but I was wondering something.

Does anyone know if there is one of these "meme" things that shows Mister Yagami from Death Note saying "just as pla-" and then getting hit in the face by a shovel? I was only wondering so that 1. I don't copy somebody elses art work. 2. I will learn to create that solely for the fact that one is not in existence yet.

Thank you for your time.

Oh yes and the "because she is a woman" thing is quite funny, my brother got a little book filled with them for Christmas: "what happens when a man gets married? He leaves being single and becomes monotonous" :-)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 29 Dec 2008, 15:46
I know the what you are talking about,but i cant help ya with it.
Sorry wish i could.


Sounds like a nice book though.

Hope you find it,Good luck!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 29 Dec 2008, 16:27
upon reflection it's kinda dumb, but it still made me chuckle
http://www.youtube.com/watch?v=ENchZIW5igQ&feature=related
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 29 Dec 2008, 18:35
In response to Troll's post
(http://img72.imageshack.us/img72/2628/dexterslabjb9.jpg)

and this
(http://img72.imageshack.us/img72/3692/mortalkombatwu6.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 30 Dec 2008, 09:39
(http://media.abum.com/image/13805.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 30 Dec 2008, 10:01
I don't know, dude.  Toad is still pretty useless.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 30 Dec 2008, 11:17
Tits.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 30 Dec 2008, 11:20
makes toad much more top heavy than usual.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 30 Dec 2008, 13:05
What the fuck is up with that peach? seriously, that's just terrible. Toad is alright, but, oh god, that peach... I don't want to look at it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 30 Dec 2008, 15:18
I hear you there.
Toad: I'm sorry, but the princess is in another castle.
Mario: And thank God for that! Now c'mere, I wanna make motorboat noises.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 30 Dec 2008, 15:58
Ah, Mario has a zest for life.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 30 Dec 2008, 17:26
http://consumerist.com/5120176/the-15-grossest-stories-weve-posted-on-consumerist-this-year?skyline=true&s=x
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 30 Dec 2008, 17:44
Holy shit that last one is disgusting.
The comments are none too great either.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 30 Dec 2008, 17:49
I haven't even read that one yet. I'm still retching about the goobers.

ADDITION: food for thought
http://consumerist.com/5117663/was-george-bailey-just-a-subprime-lender
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 30 Dec 2008, 19:34
(http://www.robrob8.com/pictures/images/video_professor.jpg)

Why hello, pagebreak.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: allison on 30 Dec 2008, 19:58
That dude looks like a worn-out version of Jack Layton, leader of Canada's New Democratic Party and part-time superhero!
(http://i35.photobucket.com/albums/d158/dream_loud/jack-layton-ndp-leader.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 30 Dec 2008, 20:27
And he in turn looks kinda like Richard Dreyfuss.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 30 Dec 2008, 20:49
Who was in Stand By Me with Kiefer Sutherland
Who was in Flatliners with Kevin Bacon!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 30 Dec 2008, 21:17
Awww right, rocking the Dr.Phil look
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 30 Dec 2008, 21:36
http://www.youtube.com/watch?v=qbar3nsf0_U
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: _Allan_ on 30 Dec 2008, 21:59
Here are some more prevent-it adds. (http://au.youtube.com/watch?v=MwCyVku1HvI&feature=related) Man, serious business.
We take our PSA's and "safety" very seroiusly ... have you see our Cig packages?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 30 Dec 2008, 22:03
Guys this clip is basically the new Chuggo spread the word (http://au.youtube.com/watch?v=19XmNXeAvIg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Christophe on 30 Dec 2008, 22:14
What in the holy motherfuck

That being said, what an odd way to determine if you've been two-timed. I predict "Can I smell your dick" being a pickup line for about a month.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 30 Dec 2008, 22:21
Do a barrel roll! (http://www.youtube.com/watch?v=4TyYgxTkTEA)

(Despite the link text you might actually find the video to be new)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 30 Dec 2008, 22:29
Spengbab

(http://i9.photobucket.com/albums/a55/ddovey/Spengbab.jpg)

Spangboob

(http://i9.photobucket.com/albums/a55/ddovey/Spengbob.jpg)

Spingblorb

(http://i9.photobucket.com/albums/a55/ddovey/sludgedog.jpg)

Spudgob

(http://i9.photobucket.com/albums/a55/ddovey/1181973348967.jpg)

Slogburp

(http://i9.photobucket.com/albums/a55/ddovey/Spengbab2.jpg)

Speurlbib

(http://i9.photobucket.com/albums/a55/ddovey/1181973323361.jpg)

Srthdub

(http://i9.photobucket.com/albums/a55/ddovey/spengbab_by_arumise.jpg)

Huglgblal

(http://i9.photobucket.com/albums/a55/ddovey/spengbab3.png)

fffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff

(http://i9.photobucket.com/albums/a55/ddovey/thingbob.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dazed on 30 Dec 2008, 22:34
The last one looks like something from hell in Gaiman's Sandman.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 30 Dec 2008, 22:35
Quote
why you coming home at five in the morning
something's going on, can i smell your dick
don't play me like a fool, cause that ain't cool
so what you need to do is let me smell your dick

absolutely incredible. i am honestly kind of upset at myself now for not having come up with this first.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 30 Dec 2008, 22:37
http://www.youtube.com/watch?v=WEzlBwaFKHc&feature=channel
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 31 Dec 2008, 00:15
Disturbing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 31 Dec 2008, 03:00
What in the fuck Joe?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 31 Dec 2008, 04:46
Haha, yeah, I saw that before. So funny.

Right after I clicked post, I realized, "wow, that was a terrible post. I should go add more" So here I am, trying to think of something random to add.

Oh, how about a knock knock joke. Its pretty tasteless though. If not good for a little chuckle.

Knock Knock.
Who's there?
9/11
9/11 who?
YOU SAID YOU'D NEVER FORGET!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: supersheep on 31 Dec 2008, 06:20
This is a thing.

http://au.youtube.com/watch?v=4pXfHLUlZf4
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: allison on 31 Dec 2008, 08:35
It's still not as funny as Dick in a Box.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 31 Dec 2008, 10:26
(http://img139.imageshack.us/img139/5066/tfdeathhh3.jpg)
(http://img139.imageshack.us/img139/1046/tfrockii3.jpg)
(http://img168.imageshack.us/img168/5397/tfspartawh0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 31 Dec 2008, 10:40
(http://newmedia2.funnyjunk.com/pictures/Picture1.jpg)
(http://newmedia2.funnyjunk.com/pictures/a95_p4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Luke C on 31 Dec 2008, 11:11
(http://photos-c.ll.facebook.com/photos-ll-snc1/v1948/59/83/1527820353/n1527820353_124298_5113.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 31 Dec 2008, 12:10
I can't not post this now that punny picture has been posted.

http://www.instructables.com/id/PortalRickroll-Cake/

Kat is the best gift giver ever.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ceiling Cat on 31 Dec 2008, 15:17
Look around you. (http://"http://uk.youtube.com/watch?v=drE5cHe6c3s")
Look AROUND you. (http://"http://uk.youtube.com/watch?v=2xQQbufJW8w&")
Just look around you! (http://"http://uk.youtube.com/watch?v=2eVN55NEREo")
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: fozmo on 31 Dec 2008, 15:31
(http://img.photobucket.com/albums/v124/BCStud31/link-silverfaustx.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 31 Dec 2008, 15:33
Haha.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 31 Dec 2008, 15:43
Look around you. (http://"http://uk.youtube.com/watch?v=drE5cHe6c3s")
Look AROUND you. (http://"http://uk.youtube.com/watch?v=2xQQbufJW8w&")
Just look around you! (http://"http://uk.youtube.com/watch?v=2eVN55NEREo")

http://uk.youtube.com/watch?v=drE5cHe6c3s
http://uk.youtube.com/watch?v=2xQQbufJW8w&
http://uk.youtube.com/watch?v=2eVN55NEREo

Code: [Select]
<A HREF="[YOUR LINK HERE]">WORDS GO HERE</A>
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 31 Dec 2008, 15:56
Code: [Select]
[url=http://uk.youtube.com/watch?v=drE5cHe6c3s]link title[/url]
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 31 Dec 2008, 16:33
oh, I didn't even know about that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 01 Jan 2009, 01:49
(http://imgs.xkcd.com/comics/fetishes.png)

SO MUCH WIN
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: _Allan_ on 01 Jan 2009, 07:31
(http://img503.imageshack.us/img503/8102/bobbm4.jpg) (http://img503.imageshack.us/my.php?image=bobbm4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 01 Jan 2009, 09:21
You're right, but if he went with Cantor instead of Godel it would be an excellent joke (that I imagine many fewer people would get fully).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: _Allan_ on 01 Jan 2009, 09:41
Oh, I know, I just really wanted to post my Bob pic *LOL*
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: glyphic on 02 Jan 2009, 13:16
Little did I know that my girlfriend was an accomplished dinosaur rider!
(http://i219.photobucket.com/albums/cc25/glyphic17/SDC10971.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 02 Jan 2009, 13:58
and now for something completely different
(http://newmedia2.funnyjunk.com/pictures/Badly-logo001.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: supersheep on 02 Jan 2009, 14:07
What is the world coming to? (http://uk.youtube.com/watch?v=KFKBorVwi0I&feature=related)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 02 Jan 2009, 14:08
Oh my god thats funny as hell,at first i thought it was "Kid sex change" Then i read it again and laughed.


Nice find vary funny.


@Supersheep:I agree,what the ****.

I hate young people  :laugh:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ceiling Cat on 02 Jan 2009, 16:23
Look around you. (http://"http://uk.youtube.com/watch?v=drE5cHe6c3s")
Look AROUND you. (http://"http://uk.youtube.com/watch?v=2xQQbufJW8w&")
Just look around you! (http://"http://uk.youtube.com/watch?v=2eVN55NEREo")

http://uk.youtube.com/watch?v=drE5cHe6c3s
http://uk.youtube.com/watch?v=2xQQbufJW8w&
http://uk.youtube.com/watch?v=2eVN55NEREo

Code: [Select]
<A HREF="[YOUR LINK HERE]">WORDS GO HERE</A>

Oops! Cheers for the code  :-)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ampersandwitch on 02 Jan 2009, 22:50
(http://i44.tinypic.com/5tuhcy.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Spike on 02 Jan 2009, 23:10
Burgler gets chased off by man dressed as a Norse God (http://news.bbc.co.uk/2/hi/uk_news/scotland/edinburgh_and_east/7807920.stm)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 03 Jan 2009, 01:38
Something else for you to become addicted to online:

Hell On $5 a Day! (http://www.brainhandles.com/2008/11/26/hell-on-5-a-day-intro-and-chapter-1/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 03 Jan 2009, 02:20
tl;dr
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 03 Jan 2009, 03:09
What does that mean?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 03 Jan 2009, 04:07
too long; didn't read.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 03 Jan 2009, 05:08
Shamwow

The thing that bugs me about that commercial is when the guy says "This is made in Germany, you know the Germans always make high quality stuff!"

What? Is this some kind of conventional wisdom that I have been left out on? I mean I'm sure the Germans make things just fine, but since when are they the pinnacle of "quality" goods?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 03 Jan 2009, 05:10
I hear Germans make fantastic ovens.

For pastries and stuff
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Masterbainter on 03 Jan 2009, 05:56
they make good dictators
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: SonofZ3 on 03 Jan 2009, 06:33
Shamwow

The thing that bugs me about that commercial is when the guy says "This is made in Germany, you know the Germans always make high quality stuff!"

What? Is this some kind of conventional wisdom that I have been left out on? I mean I'm sure the Germans make things just fine, but since when are they the pinnacle of "quality" goods?

Actually, they kind of are in relation to a lot of things. Zeiss and Swarovski optics and crystal, arguable the best in the world, are german companies. Muhle Glaschute watches are said to be extremely fine watches, and the same can be said about Sinn and other German watchmakers. Some of the best fly reels for fishing come from Germany. There was a time when American made cars couldn't be expected to last more than a few years, during that time Mecedes Benz automobiles were referred to as a "10 year car" because, unlike American and other foreign vehicles, Benz (and BMWs) would last for 3 or 4 times as longer than domestic counterparts. Though its reaching back quite far, the small tolerances and precision engineering on weapons during WWII made German produced weapons and machinery the most finely made. Historians have even said that exceedingly high quality of German engineered machinery, instead of mass production, helped to lose the war for Germany. Basically, Germany has a history of producing amazingly high quality in anything that requires preicison machined parts. Now, the Shamwow isn't machined, but in relation to some things German Made= Quality.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: supersheep on 03 Jan 2009, 08:25
THIS IS THE POINTLESS THREAD

GET OUT

GET OUT NOW
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 03 Jan 2009, 12:01
(http://mfrost.typepad.com/photos/uncategorized/2008/12/27/img_1876.jpg)



d'aaaaaaaaaaawwwwwww
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 03 Jan 2009, 12:54
That is cute.


So Cute.


So vary vary Cute.



MOAR!!!11
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mbb on 03 Jan 2009, 13:18
Poor little guy. :( Recently my bf's dad's gf's ex-husband's (following me?) dog had to have a cast. They initially put on a pink one like that, but he had them swap it out for a blue one because "a guy dog shouldn't have a pink cast".
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: thegreatbuddha on 03 Jan 2009, 14:29
FOX News (http://www.huffingtonpost.com/2009/01/02/fox-news-airs-magic-negro_n_154761.html), how we love you.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 03 Jan 2009, 14:35
I love how they get all defensive and self-righteous like they're ten or something. I'm not even particularly offended by the message, it was probably just a couple of people wishing their black friend or relative to do well, but then Fox has to be all twatty about it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 03 Jan 2009, 14:39
linked from that post was this one:
http://www.huffingtonpost.com/2009/01/01/kathy-griffins-dicks-joke_n_154643.html

Ordinarily Kathy Griffin annoys me, but that was pretty awesome.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: negative creep on 03 Jan 2009, 14:43
But, but, he speaks the truth! MG42 is arguably one of the finest heavy machine guns ever created! They last for fucking ever, the Norwegian army just stopped using the last of them twenty years ago.

And, if I'm informed correctly, now they're using the MG3, which is basically just a slightly modded version of the MG42 that uses standard NATO ammunition.

And of course both the Leopard 1 and Leopard 2 tanks and several assault rifles by Heckler & Koch.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Edith on 03 Jan 2009, 17:27
http://www.dirtyjokesinc.com/joke-dirty_jokes-9138.htm (http://www.dirtyjokesinc.com/joke-dirty_jokes-9138.htm)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 03 Jan 2009, 17:59
rape is funny.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Edith on 03 Jan 2009, 18:05
That is the worst joke I've ever read.

It made me laugh because it makes no sense at all.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dazed on 03 Jan 2009, 18:07
Where was the joke part of that joke. There wasn't even a recognizable punchline.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Christophe on 03 Jan 2009, 18:08
"THE ARISTOCRATS!"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 03 Jan 2009, 18:09
the comments are by far the worst part -

Quote
That joke is disgusting but funny & cute.

yes, those are my views on molestation as well
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 03 Jan 2009, 18:18
jens i see your terrible joke and raise you this (http://www.dirtyjokesinc.com/joke-sex_jokes-16983.htm)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Josefbugman on 03 Jan 2009, 18:29
Quick something I just saw, and as this is the pointless thread I am unlikely to be penalised for bringing it up. Christian Bale, at the age of 9 selling Pacman breakfast cereal... I love early morning TV
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eris on 03 Jan 2009, 18:36
Quote from:  that site
Signs of Drug Abuse:

    * runny nose
    * puffy eyes
    * loss of appetite
    * cranky or moody
    * want alone time frequently
    * aggressiveness
    * crying alot


Wat
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 03 Jan 2009, 19:57
http://www.dirtyjokesinc.com/joke-dirty_jokes-16745.htm

Put your mouse over the word "Baby",and read the window that shows up.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 03 Jan 2009, 20:49
CAPITALISM IN ACTION!
(http://newmedia2.funnyjunk.com/pictures/star_wars_lawn_fertilizer.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 03 Jan 2009, 20:54
Oh my god.

I need that.

My plant needs that. Augustus must become a Jedi, damn it. (Augustus is my aloe plant.)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Inlander on 03 Jan 2009, 21:33
AMUSING SIGNS SEEN AROUND TOWN
Part 1 in an occasional series


Riding into the city this afternoon I passed by a construction site. As is often the case, the temporary walls around the construction site were adorned with the name of the firm responsible for either the construction or the design of the building being built (it was unclear which). As is also often the case, the name of the company was comprised of two surnames, presumably those of the original or principle partners in the firm. The name of the company was:

HOOKER
COCKRAM
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 03 Jan 2009, 22:01
(http://img384.imageshack.us/img384/1698/happybirthdaynh7.jpg)

(http://img84.imageshack.us/img84/8936/confusedgolbatswi6.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 03 Jan 2009, 23:04
(http://img329.imageshack.us/img329/2531/djmsfv462oiqse7.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Inlander on 03 Jan 2009, 23:48
I was catching up on old pages of this thread earlier, and saw the post about the Obama dildo.

Then just now there was something on the news about the American economy, and Obama's "MASSIVE STIMULUS PACKAGE".

I smiled.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 03 Jan 2009, 23:51
D'awwww (http://www.huffingtonpost.com/2009/01/02/damon-weaver-student-jour_n_154869.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 03 Jan 2009, 23:53
I sure wish a politician would do something to stimulate my economy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Stryc9Fuego on 04 Jan 2009, 02:04
I just want to back up a sec and say that whenever I hear about German quality, it makes me think of those V-Dub (http://en.wikipedia.org/wiki/VDub) commercials.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 04 Jan 2009, 08:25
If yelley ever comes into this thread I have a feeling that she will like this:

(http://www.thedailyweird.com/wp-content/uploads/scrabble-tombstone.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 04 Jan 2009, 12:35
She will like blank nothingness?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 04 Jan 2009, 12:45
(http://i236.photobucket.com/albums/ff100/imagercc1/archive/page13/scrabbletombstone_700.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Edith on 04 Jan 2009, 12:51
I can see it on liz's post now that I went to the website and allowed the scripts for that page.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 04 Jan 2009, 12:57
(http://www.thedailyweird.com/wp-content/uploads/bacon-tattoo.jpg)
(http://news.bmezine.com/wp-content/uploads/200609072004-pix1.jpg)
(http://img.photobucket.com/albums/v467/metalchick666/blog%20stuff/l_cfcf62186c4a5f31d01c9f98cca16eed.jpg)
(http://www.seriouseats.com/required_eating/images/pigtattoo.jpg)
(http://img.photobucket.com/albums/v467/metalchick666/blog%20stuff/tattoo_small.jpg)
(http://www.seriouseats.com/required_eating/images/pigtattoo.jpg)
(http://img.photobucket.com/albums/v467/metalchick666/blog%20stuff/photo-765817.jpg?t=1213156264)
(http://img.photobucket.com/albums/v467/metalchick666/blog%20stuff/1680551688_3931d2a455.jpg?t=1213156431)
(http://img.photobucket.com/albums/v467/metalchick666/blog%20stuff/pictures31201.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 04 Jan 2009, 13:17
That Scrabble gravestone is cute but depressing. The guy was so young (and engaged, and had siblings).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Vendetagainst on 04 Jan 2009, 18:39
This man is upset with you (http://www.craigslist.org/about/best/tor/649999147.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: fozmo on 04 Jan 2009, 19:26
Scrabble tombstone is missing a double word score just to the right of "son"

/pointless
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Inlander on 04 Jan 2009, 19:40
Yes. I'm sure that troubled the family at the time.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 04 Jan 2009, 22:29
This man is upset with you (http://www.craigslist.org/about/best/tor/649999147.html)

Oh my, (http://www.craigslist.org/about/best/lax/944397175.html) this is the first time I've ever actually looked at craigslist.

Edit: Also, (http://www.craigslist.org/about/best/pit/933339437.html)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 04 Jan 2009, 23:48
Oh gosh.

I lost a screenshot of a craigslist ad that I had on my old computer, but it went something like this.

"i found a single page of pornography behind Balucci's Indian restaurant.

if it is yours, please come pick it up. it made me very uncomfortable"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Inlander on 05 Jan 2009, 05:08
"Balucci's Indian Restaurant"? ? ?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 05 Jan 2009, 13:35
the more you know!
(http://newmedia2.funnyjunk.com/pictures/n1539546609_30094756_571.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 05 Jan 2009, 14:05
Awesome.

I would so stop by for a nights stay.


To bad i wont need to anytime soon  :cry:
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 05 Jan 2009, 14:08
(http://img90.imageshack.us/img90/8355/clonewarvethv3.jpg)

(http://img530.imageshack.us/img530/774/myboomstickbw8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 05 Jan 2009, 18:47
(http://bp0.blogger.com/_HDLEycm-LIE/Rm9hbEl71AI/AAAAAAAACQ8/8fbiyk_TNYk/s400/LoisLane080-020.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 05 Jan 2009, 18:50
"Balucci's Indian Restaurant"? ? ?

http://www.baluchis.com/

I misspelled it originally.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 05 Jan 2009, 19:03
(http://newmedia2.funnyjunk.com/pictures/then-i-went-to-hell.jpg)
(http://newmedia2.funnyjunk.com/pictures/georgia.jpg)
(http://newmedia2.funnyjunk.com/pictures/weatherforecaststone.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Inlander on 05 Jan 2009, 23:37
That church sign is amazing.

The most amazing part is the slogan: "Finding and feeding his sheep". I mean, I know there's the whole flock/shepherd metaphor going on in Christianity, but I've never heard of a church actually referring to its congregation as sheep.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MarkTBSc on 06 Jan 2009, 00:20
So... Let me just be sure I've got this right... If I kiss a girl and like it then I'm going to hell? So if I kiss a boy and like it, kiss a girl and don't like it or kiss a boy and don't like it then I'm fine?

Well, the gay men are OK, as are the straight women... It's the straight men and lesbians who are in trouble.

This is why I prefer Atheism... And sheep.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 06 Jan 2009, 01:04
whaaaaaaaaaaaaaaaa

(http://i159.photobucket.com/albums/t133/BloodRedLIon/wtf.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 06 Jan 2009, 07:53
I FUKKEN HATE JUICE!!

(http://littlegreenfootballs.com/weblog/pictures/20081229NYDeathJuice.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 06 Jan 2009, 08:36
This caused me to laugh.
(http://i352.photobucket.com/albums/r326/REEKA0408/000_0048-2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ceiling Cat on 06 Jan 2009, 10:56
Speaking of funny church signs, there's this church near me that has a sign saying, 'God invented the weekend.' Every time I see it I'm like NO WAI.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: morca007 on 06 Jan 2009, 10:58
I FUKKEN HATE JUICE!!
(http://img218.imageshack.us/img218/1743/ihaveelimenatedallthejuhi1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Barmymoo on 06 Jan 2009, 11:15
... I don't actually want to know where they got that costume from, or why he is wearing it.

On the slightly old topic of bad jokes, here is my favourite:

What's blue and square?
An orange in disguise.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 06 Jan 2009, 11:41
I give you guys Rock Smith.

(http://i28.photobucket.com/albums/c213/hey_there_fatty/ROCKSMITH.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 06 Jan 2009, 11:54
I do not know what to say about that, It creeps me out.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 06 Jan 2009, 12:45
At first all i could do was tilt my head to the side to see it,then i laughed. Nice. Vary nice.
I'd like to see other stars done like that,he looks awesome btw.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 06 Jan 2009, 13:07
(http://images3.wikia.nocookie.net/starwars/images/0/05/How_StarWars_Changed_the_World.jpg)

(http://i427.photobucket.com/albums/pp358/mgsfan102/zoomoutuniverse.gif)

(http://i14.photobucket.com/albums/a304/blahblahnuggets/tree.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 06 Jan 2009, 14:22
FFFFFUUUUUUUUUCCCK, I AM SMALL AND INSIGNIFICANT.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 06 Jan 2009, 14:24
Aw man, that Hubble Deep Field data is incredible.

More on that (http://www.youtube.com/watch?v=mcBV-cXVWFw).
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 06 Jan 2009, 17:34
woah,my mind,she is blown.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 06 Jan 2009, 17:42
Narration makes me angry.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Josefbugman on 06 Jan 2009, 17:44
FFFFFUUUUUUUUUCCCK, I AM SMALL AND INSIGNIFICANT.

So is everyone else though, so it all balances out.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: greenMonkey on 06 Jan 2009, 19:42
Narration makes me angry.

Seriously.  That guy is no Morgan Freeman.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Mr. Mojo on 06 Jan 2009, 20:09
Aw man, that Hubble Deep Field data is incredible.

More on that (http://www.youtube.com/watch?v=mcBV-cXVWFw).

I usually use the same argument he does about the idea of so many planets and galaxies there must be other life.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 06 Jan 2009, 21:42
(http://technologizer.files.wordpress.com/2008/12/oldpatents-voicecontrol.png?w=535&h=350)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 06 Jan 2009, 22:24
Shit, someone sells air guitars guys
(http://newmedia2.funnyjunk.com/pictures/Air_Guitar.jpg)
They're going fast you better hurry
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 06 Jan 2009, 23:26
Shit, that's an old fashioned Stratocaster air guitar.
And at that price, it's a steal.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 06 Jan 2009, 23:42
Fuck that, you could make your own for half the price.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 07 Jan 2009, 00:26
Double post for:

http://www.jacksonpollock.org/
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 07 Jan 2009, 03:08
Double post for:

http://www.jacksonpollock.org/

Ralph Steadman?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Clintaga on 07 Jan 2009, 08:58
Quote
No ski bum jokes, please: Man gets stuck upside-down, bare-bottomed on Colo. ski lift

By Associated Press
    8:02 PM CST, January 6, 2009

VAIL, Colo. (AP) A guy who dangled upside down from a ski lift with his bare bottom exposed probably doesn't want to hear any "ski bum" jokes. Officials at Vail Resorts in Colorado say the 48-year-old man was trying to get on the Blue Ski basin lift on New Year's Day. They haven't said what went wrong.

Workers stopped the lift, backed it up 10 or 12 feet and rescued the man after about seven minutes. His name hasn't been released.

Bystanders snapped photos and posted them on the Internet, showing a man who looks to be hanging by one ski boot, his ski pants and underwear apparently snagged in the chair and reaching no farther than his knees.

Vail spokeswoman Liz Biebl confirmed the photos on one site were, in fact, the victim.

Pic Found: (http://i.cdn.turner.com/trutv/thesmokinggun.com/graphics/art4/0106091vail4b.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: redglasscurls on 07 Jan 2009, 10:09
People under 40 still wear white underwear??
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 07 Jan 2009, 10:43
Judging by his arse, I'd say he's roughly 48.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 07 Jan 2009, 11:35
When did you develop the ability to judge a person's age by the appearance of their ass?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 07 Jan 2009, 11:46
High school biology.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dimmukane on 07 Jan 2009, 12:06
That, and, you know, it's in the article quoted right above it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 07 Jan 2009, 12:08
Man, what kind of biology class was that?

"Today we will take an in-depth look at identifying how old a person is by the contours of the lines in their ass-cheeks!"
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: schimmy on 07 Jan 2009, 12:13
In the case of men, it's really just a matter of a few formulae based on how much the arse just looks like it's part of the rest of the body.

That, and, you know, it's in the article quoted right above it.

Shh, man, shh.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 07 Jan 2009, 13:32
(http://img186.imageshack.us/img186/2248/koolaidhh9.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 07 Jan 2009, 17:36
http://www.metaphilm.com/philm.php?id=29_0_2_0

Calvin & Hobbes/Fight Club parallels.

Oh my god I love you Matt.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: morca007 on 07 Jan 2009, 19:10
(http://img385.imageshack.us/img385/4381/b36ab86121243e7dfe8ae43jk0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 07 Jan 2009, 20:42
Uhh...


Dude thats messed up.

Big time.  :|
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: abadname on 07 Jan 2009, 20:45
(http://imagechan.com/images/pipe.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 07 Jan 2009, 20:49
That made me laugh.

Well done. Well done.


 :-)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Inlander on 07 Jan 2009, 21:25
Yup, nothing says chuckles like barely suppressed homicidal rage within the context of a suffocating marriage to a latently violent man.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 07 Jan 2009, 21:38
Man, I was going to post that next, just waiting for the right time to pull it out.  Damn, all that searching for nothing now.

(http://img211.imageshack.us/img211/3619/rasputinmoorevk8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: celticgeek on 07 Jan 2009, 21:51


"And I went to see the doctor of philosophy
With a poster of rasputin and a beard down to his knee"

 - Indigo Girls, Closer To Fine
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 07 Jan 2009, 23:27
Some random "Wow, people can do that?" videos.

A master musician clearly enjoying himself. (http://video.stumbleupon.com/#p=tfjsg7u3ww)

Awesome beatboxing doesn't get old. (http://www.metacafe.com/watch/1550687/gypsy_rhythm_machine_crazy_beatbox/)

Expecially not when it's REALLY funny. (http://www.metacafe.com/watch/1467459/beatbox_cookery_lesson_with_beardyman/)

... OK, I didn't want to double-post, but I had to put this here.  This video inspires such a deeply visceral positive reaction from me that it literally hurts to resist smiling while I'm watching it.  Rand proposes to Geraldine (http://video.stumbleupon.com/#p=gydda2dqqr)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 08 Jan 2009, 06:23
Double post for:

http://www.jacksonpollock.org/

We're actually using that at work as part of an activity on a kids website. We contacted that guy and he sent us the Flash file.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 08 Jan 2009, 08:16
That was pretty ace, but I hope when I propose to the girl of my dreams she will not be saying "WHAAAAT?" over and over again.

You cannot know this for sure.

Things can be... arranged.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Edith on 08 Jan 2009, 10:14
http://cosmos.bcst.yahoo.com/up/player/popup/?rn=3906861&cl=11444512&ch=4226713&src=news (http://cosmos.bcst.yahoo.com/up/player/popup/?rn=3906861&cl=11444512&ch=4226713&src=news)

Bitch better give it back.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 08 Jan 2009, 10:44
(http://rumblo.com/cc/comics/cc-tmas.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 08 Jan 2009, 11:00
Bitch better give it back.

Couldn't agree more.

Also, http://uk.youtube.com/watch?v=3HWqO8_ddxg (http://uk.youtube.com/watch?v=3HWqO8_ddxg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 08 Jan 2009, 15:24
(http://newmedia2.funnyjunk.com/pictures/all_daddy_wanted.jpg)
(http://newmedia2.funnyjunk.com/pictures/diet-coke-with-bacon-only-america.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: 0bsessions on 08 Jan 2009, 15:33
I could legitimately imagine myself drinking that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 08 Jan 2009, 20:58
(http://img248.imageshack.us/img248/5297/cutebatmanki7.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 08 Jan 2009, 22:36
When Cakes Attack! (http://cakewrecks.blogspot.com/)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 09 Jan 2009, 15:33
The Recently Deflowered Girl (http://community.livejournal.com/found_objects/3699822.html?page=1)

A funny but somewhat odd book.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Eli on 09 Jan 2009, 15:37
That reminds me of this: http://community.livejournal.com/scans_daily/2388850.html
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 09 Jan 2009, 15:51
Orbert I need that book.

Man I need to find every used book store that exists and find myself a copy.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 09 Jan 2009, 16:15
oh man oh man orbert, that book is absolute gold.  i can't stop laughing!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 09 Jan 2009, 16:16
Fucking CAKE!

(http://img.photobucket.com/albums/v619/ackblom12/2083342822_17f5479606.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 09 Jan 2009, 16:39
holy shit.
how do you go about making something like that? i don't think i could ever bring myself to eat it, it's too amazing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: fozmo on 09 Jan 2009, 17:42
(http://www.cynical-c.com/archives/bloggraphics/po_10_lg.jpg)
(http://davidmalki.com/wed/cake.jpg)

MikesAmazingCakes.com (http://MikesAmazingCakes.com)

Edit: Wow, I can't spell simple words. And somehow I almost screwed it up again fixing it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Boro_Bandito on 09 Jan 2009, 17:43
that url is misspelled fozmo.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Dazed on 09 Jan 2009, 22:28
(http://img412.imageshack.us/img412/4535/n7239715382144521569qn1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 09 Jan 2009, 22:41
(http://img515.imageshack.us/img515/4291/bloodybunnymn8.png)

(http://img515.imageshack.us/img515/4883/clvermanhm4.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Inlander on 10 Jan 2009, 01:38
Oh boy, helloooo new avatar.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 10 Jan 2009, 02:09
Awww, you beat me to it, Harry.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 10 Jan 2009, 08:38
(http://www.pieterhugo.com/nigeria/images/17.jpg)

Just me and my baboon, kickin' it in the yard.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gemmwah on 10 Jan 2009, 08:58
It still makes me smile that the baboon is wearing trousers and a t-shirt.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wolf on 10 Jan 2009, 11:07
Exploding Banana Face Man

http://www.youtube.com/watch?v=3NBVPzGDPT0&eurl=http://slog.thestranger.com/blogs/slog/ (http://www.youtube.com/watch?v=3NBVPzGDPT0&eurl=http://slog.thestranger.com/blogs/slog/)

banana number seven is the best
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 10 Jan 2009, 13:29
couldn't remember if this had already been posted or not: self defense (http://uk.youtube.com/watch?v=2REG3-Wb5gM)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 10 Jan 2009, 13:53
Exploding Banana Face Man

http://www.youtube.com/watch?v=3NBVPzGDPT0&eurl=http://slog.thestranger.com/blogs/slog/ (http://www.youtube.com/watch?v=3NBVPzGDPT0&eurl=http://slog.thestranger.com/blogs/slog/)

banana number seven is the best

Christ. That's horrifying.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 10 Jan 2009, 16:41
(http://newmedia2.funnyjunk.com/pictures/eggs098.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 10 Jan 2009, 16:51
(http://img218.imageshack.us/img218/6973/scarygg4.jpg)

(http://img404.imageshack.us/img404/9017/handzr2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 10 Jan 2009, 19:49
Why does this thread periodically go through phases where it becomes the "oh, wow that is really sad/depressing and/or terrifying/disgusting" thread?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tania on 10 Jan 2009, 20:04
it's not necessarily the funny thread, just the pointless thread, although 95% of the stuff that goes in here is funny cos people tend to enjoy sitting around and laughing more than being frightened or grossed out. but it makes sense also to use it as a general place to post things you want other people to see but that wouldn't be enough to warrant their own threads.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 11 Jan 2009, 00:07
 Man I wish somebody could have put that line at the beginning of the original Pointless Thread, Tania. That would have saved us so much nonsense. Why are you never useful when we need you to be?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 11 Jan 2009, 02:44
(http://i40.tinypic.com/2eav0if.jpg)

(http://i40.tinypic.com/t0jbif.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: ackblom12 on 11 Jan 2009, 03:07
(http://img.photobucket.com/albums/v619/ackblom12/weasels-1.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 11 Jan 2009, 03:57
What the...  :?


That is by far the strangest thing i have seen all day. So far anyway.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: carrotosaurus on 11 Jan 2009, 08:01
(http://img.photobucket.com/albums/v299/partyongarth/Weasels_Ripped_My_Flesh.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 11 Jan 2009, 18:50
The Man From B.U.S.E.Y.

(http://i9.photobucket.com/albums/a55/ddovey/garybuseyRADICAL.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Scrambled Egg Machine on 12 Jan 2009, 13:08
That kid, despite the photo-shopped face, is now my role model.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 12 Jan 2009, 14:00
(http://img.photobucket.com/albums/v374/Seseilia/FIGHTERPLANE.jpg)
(http://img.photobucket.com/albums/v374/Seseilia/BULL.jpg)
(http://img.photobucket.com/albums/v374/Seseilia/FERRERRI.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 12 Jan 2009, 15:11
They are!  My son has some of them and he had a great time with them.  Of course, he was like eight at the time, but still.

Granted, that "fighterplane" looks a lot like a helicopter, the "bull" is fine but the rhino pic is baffling, and the "Ferarri" resembles a pleisiosaur but apparently flies, but what are you expecting for 72 cents?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 12 Jan 2009, 15:21
Granted, that "fighterplane" looks a lot like a helicopter, the "bull" is fine but the rhino pic is baffling, and the "Ferarri" resembles a pleisiosaur but apparently flies, but what are you expecting for 72 cents?

I think thats the joke??
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 12 Jan 2009, 15:24
(http://newmedia2.funnyjunk.com/pictures/7a907a0b56d7d7526465d5cbc920bb5b9a847dc5_m.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 12 Jan 2009, 15:27
Hahaha thats great,we all need more best friends like that!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Professor Snuggles on 12 Jan 2009, 16:28
(http://photos-b.ak.fbcdn.net/photos-ak-sf2p/v125/216/8/1368210146/n1368210146_30086609_9662.jpg)
(http://i40.tinypic.com/287m6ih.jpg)


Also, that obama thing is amazing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: carrotosaurus on 12 Jan 2009, 17:03
(http://img.photobucket.com/albums/v299/partyongarth/2004798005844362867_rs.jpg)

(http://img.photobucket.com/albums/v299/partyongarth/20081112_d-0077-5-515h.jpg)

(http://img.photobucket.com/albums/v299/partyongarth/clownmeat.jpg)

(http://img.photobucket.com/albums/v299/partyongarth/shitinmykitchen.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 12 Jan 2009, 17:18
Hahahaha Frank the shiter! OOOOO watch out folks Hahahaha!

Thats awesome.


Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 12 Jan 2009, 19:31
 What the holy moly is up with that first picture? Yuck.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 12 Jan 2009, 20:17
From the creator of Adventure Time

The Bravest Warrior (http://www.youtube.com/watch?v=ypJOq2vYfe8)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 12 Jan 2009, 20:43
I didn't make the connection when I saw Adventure Time, but watching that video it dawned on me how similar it is to the animations made by Paper Rad. (http://en.wikipedia.org/wiki/Paper_Rad)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 13 Jan 2009, 01:11
Mr. Chi City is a hilarious man (http://www.collegehumor.com/video:1896242)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Orbert on 13 Jan 2009, 10:37
Granted, that "fighterplane" looks a lot like a helicopter, the "bull" is fine but the rhino pic is baffling, and the "Ferarri" resembles a pleisiosaur but apparently flies, but what are you expecting for 72 cents?

I think thats the joke??

I know, but I found it amazing that the kits were only 72 cents and had to find a way to lead into it.

Also, I'd take the flying plesiosaur over the Ferarri too.  I couldn't afford to change the oil or put gas in a Ferrari, and I'd probably wreck it inside of a year, but flying around on a prehistoric sea reptile would be sweet.  I'd let him eat my neighbor's bushes and shit in their yard, so there wouldn't really be a maintenance issue.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: allison on 13 Jan 2009, 10:45
(http://www.dobi.nu/yourscenesucks/splash.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: SirJuggles on 13 Jan 2009, 10:49
I keep clicking but I can't choose the fat girl!!!!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 13 Jan 2009, 10:56
You might want to go to the actual sight (http://www.dobi.nu/yourscenesucks/) if you're going to click on things.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Josefbugman on 13 Jan 2009, 11:39
I am like none of these people, any other sites like this, I am always interested in trying to find out what I am.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 13 Jan 2009, 12:56
 Dancing with cats (http://books.google.com/books?id=cWaFfHovuA4C&client=firefox-a)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Caleb on 13 Jan 2009, 13:01
I think most cats would just give their dancing owners a disgusted look and go back to sleep.

Or move to another room and go to sleep.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mooface on 13 Jan 2009, 13:42
Mr. Chi City is a hilarious man (http://www.collegehumor.com/video:1896242)

i want this crazy man to be my friend.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: De_El on 13 Jan 2009, 13:57
I am just baffled that this exists.
http://www.youtube.com/watch?v=87nkJquHnAU (http://www.youtube.com/watch?v=87nkJquHnAU)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 13 Jan 2009, 19:31
(http://img55.imageshack.us/img55/6272/thinkingabouteatingyouzo8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: SirJuggles on 13 Jan 2009, 22:02
Oh my goodness I have spent the last 3 hours on YourSceneSucks and all the sites it links to.

What are you people trying to do to me? I do have homework you know...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 13 Jan 2009, 23:44
(http://i44.tinypic.com/ek42tc.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 14 Jan 2009, 00:13
AAAAA

AAAA

WHAT AM I

WHO ARE YOU

I'M FUCKING MY HAND

AAAAAAAAAA

JUMP

WHAT IS THIS (http://www.youtube.com/watch?v=l_8yPap-k_s)

Sorry MrSteevo, you're quite a few pages too late on that one.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: David_Dovey on 14 Jan 2009, 03:26
(http://www.tubevision.com/LEGO_666_SUNN_1.JPG)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: McTaggart on 14 Jan 2009, 03:28
Man what the hell they even got Oren's guitar right.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ozymandias on 14 Jan 2009, 10:04
(http://www.shorpy.com/files/images/8c10160u.preview.jpg)

May 1939. "Second and third grade children being made up for their Negro song and dance at May Day-Health Day festivities." Ashwood Plantations, South Carolina.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Leonidas on 14 Jan 2009, 15:31
(http://barfblog.foodsafety.ksu.edu/HappyCow.jpg)

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 14 Jan 2009, 15:56
http://vimeo.com/moogaloop.swf?clip_id=1778399&server=vimeo.com&sho

badass
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Gilead on 14 Jan 2009, 17:12
Best craigslist? Maybe.

http://grandrapids.craigslist.org/cas/990892657.html
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Alex C on 14 Jan 2009, 17:16
Amazing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Inlander on 14 Jan 2009, 17:20
"Maybe we can meet for cocktails."

You just keep clinging to that one little fragment of normality, sir! Cling on and don't let go!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: jhocking on 14 Jan 2009, 17:48
holy shit I did not until just now watch the entire video I had posted; I posted it after watching just the first half. The bit at the end is fucking amazing, even compared to the badass shit at the beginning.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 14 Jan 2009, 18:03
That was awesome! I wanna fly too!

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: RedLion on 14 Jan 2009, 18:06
I wonder how much suits like those cost...
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 14 Jan 2009, 18:07
Yeah, that video is fucking tops.  I want to do it, but I just know I'll be the sap that loses concentration watching the scenery and ploughs into a wall or someshit.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 14 Jan 2009, 18:18
My mom just emailed me that video, I was about to post it here.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 14 Jan 2009, 18:19
Ohshit, what if Mr Hocking is my mother?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: blanktom on 14 Jan 2009, 18:20
Every time I watch a video like that my soul dies a little due to the stark reminder it gives me that my life is total drudgery.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 14 Jan 2009, 18:22
Holy shit.

Quote
At the beginning of wing suit jumping we were trying to get as far from the wall as possible; so basically clearing out the whole thing. And now it's getting boring so we play around.

Quote
And now it's getting boring so we play around.

Quote
getting boring

My only question is, how do they land? They're free falling at 100 MPH and they're way too close to the ground to use parachutes.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Social Bacon on 14 Jan 2009, 18:24
Watch the last 20 seconds of the video.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 14 Jan 2009, 19:12
Oops, I missed that. Isn't there some sort of limit to how close to the ground you can be to open a parachute though? They're pretty damn close.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 15 Jan 2009, 07:47
(http://i143.photobucket.com/albums/r155/Cleinhun/DSCN1041.jpg?t=1221269823)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 15 Jan 2009, 08:30
(http://img.photobucket.com/albums/v12/sademie/stevejobshiv.jpg)

:3
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Cartilage Head on 15 Jan 2009, 12:19
Holy guacamole.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 15 Jan 2009, 13:08
Well we know everyone loves nachos, movies, and pizza! Unfortunately my waist in not nearly that large so I guess I won't be getting any tasty treats.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 15 Jan 2009, 13:13
At least he knows what he wants :|
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: benji on 15 Jan 2009, 13:13
Well we know everyone loves nachos, movies, and pizza! Unfortunately my waist in not nearly that large so I guess I won't be getting any tasty treats.

I don't think you'd get the nachos, movies, and pizza. Those are just things he likes. You'd get to give him money and be his sex slave.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 15 Jan 2009, 13:17
Man I better get some goddamn nachos, movies, and pizza. Otherwise it is totally not worth it.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: redglasscurls on 15 Jan 2009, 13:18
Notice how he was very politically correct in his wording, saying "yeah, no fat black chicks ok?" without actually saying it. Dude's a class act.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 15 Jan 2009, 14:28
Liz when you get to Chicago I'll be sure to have those.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 15 Jan 2009, 15:11
Watch yourself, Matt. Jens will maybe fight you if you start talking like that.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 15 Jan 2009, 18:03
I doubt that's actually Steve Jobs but that sucks for whoever now has their social security number on the internet.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 15 Jan 2009, 18:15
funfact: if you've ever submitted your SSN to anything online, your information is 5 minutes and a little effort away from the same fate.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 15 Jan 2009, 18:20
Liz tell me you know those people.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 15 Jan 2009, 19:21
(http://img152.imageshack.us/img152/7237/looakalikesex5.gif)

(http://img152.imageshack.us/img152/1323/wonderwomanxm0.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 15 Jan 2009, 19:25
Surely there's been some minor shooping on both those top images to make them closer than they actually are
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 15 Jan 2009, 19:30
also

(http://img.photobucket.com/albums/v371/est_xplosif/random/image026.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 15 Jan 2009, 20:06
Liz tell me you know those people.

...what people?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 15 Jan 2009, 20:07
There was some website that did that in three seconds that popped up recently.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: JD on 16 Jan 2009, 12:00
(http://newmedia2.funnyjunk.com/pictures/dfad4f2ffe6294ff3319f723a11bdc43974376c8_m.jpg)
(http://newmedia2.funnyjunk.com/pictures/The_Secret_Life_Of_Peeps.jpg)

Edit: great page break
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: redglasscurls on 16 Jan 2009, 12:18
For some reason I really love that the chairs are made of starbursts
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: azurefirem on 16 Jan 2009, 12:30
I dunno, the pole-dancing Peep bunny kinda freaked me out.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: mberan42 on 16 Jan 2009, 12:59
Watch yourself, Matt. Jens will maybe fight you if you start talking like that.

dude is like 5'7" and 140 pounds.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 16 Jan 2009, 13:45
120.

EAT MORE FOOD. YOU WEIGH LESS THAN I DO.

(That's pretty much the first time I've ever been able to say that to any other guy who is less than 3 years younger than me)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Coward on 16 Jan 2009, 14:35
One for Matt Berry fans.

Chivalry.

http://uk.youtube.com/watch?v=I66aySW4le8
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Ballard on 16 Jan 2009, 15:56
Jace, what? You're pretty skinny.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: azurefirem on 16 Jan 2009, 15:59
Jace, what? You're pretty skinny.

I'm willing to bet I'm skinnier (5'4, anywhere from 95 to 98 lbs (it fluctuates))
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: est on 16 Jan 2009, 19:45
That is actually quite a good thing.  It's basically a step by step process on how to not be a shithead online.  I wish I could make one for the forum.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 16 Jan 2009, 19:55
(http://img206.imageshack.us/img206/669/nobodyaskedyoucu8.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 16 Jan 2009, 23:42
dude is like 5'7" and 140 pounds.

I never said he would win.

Sorry Jens, but I think just about anyone could take you in a fight.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: tragic_pizza on 17 Jan 2009, 02:42
(http://i448.photobucket.com/albums/qq204/saintburke/74.gif)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Malek on 17 Jan 2009, 04:35
Oh my god i cant belive i clicked that.

At least i know i have a mouse!
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Jace on 17 Jan 2009, 05:39
Jace, what? You're pretty skinny.

Yeah, but most people that are close to my age are not skinnier than me (jens is both close to my age, and skinnier than me) I weigh 140 or so.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: onewheelwizzard on 17 Jan 2009, 15:20
(http://i80.photobucket.com/albums/j191/Reamerer/youjustactivated.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Blue Kitty on 17 Jan 2009, 22:49
(http://www.superpoop.com/010509/owl-fight.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Inlander on 17 Jan 2009, 23:05
The man loses, for (A) having an awful hair-style; and (B) wearing a t-shirt with "Barn owl" written on it in large letters next to an illustration of an owl that is not actually a barn owl.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Jan 2009, 01:10
So I was browsing the internets when I got this pop-up:

(http://farm4.static.flickr.com/3374/3206134376_1047af74e9_o.png)

Anyone?
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Lunchbox on 18 Jan 2009, 01:37
Dammit, it was supposed to be SECRET.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Professor Snuggles on 18 Jan 2009, 01:42
Lunchbox, I wanna know how your message to me ended up on her computer though, real talk.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Slick on 18 Jan 2009, 06:45
Man, I can totally see that as being the way Lunchbox would ask someone out.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Jan 2009, 12:50
(http://www.biggeekdaddy.com/sitebuilder/images/healthy-393x468.jpg)

(http://www.geekologie.com/2009/01/14/burger-bed-2.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 18 Jan 2009, 16:24
(http://img.photobucket.com/albums/v12/sademie/3206134376_1047af74e9_o.png)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Trollstormur on 18 Jan 2009, 16:26
double poast

(http://img.photobucket.com/albums/v620/theweaselking/Thirdmain/sagittal.jpg)
(http://img.photobucket.com/albums/v620/theweaselking/Thirdmain/coronal.jpg)
(http://img.photobucket.com/albums/v620/theweaselking/Thirdmain/transverse.jpg)
(http://img.photobucket.com/albums/v620/theweaselking/Thirdmain/custom.jpg)
(http://img.photobucket.com/albums/v620/theweaselking/Thirdmain/pieces.jpg)
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Liz on 18 Jan 2009, 17:08
Well played, sir.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Tom on 18 Jan 2009, 18:51
I must have that brain puzzle thing.
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Wolf on 18 Jan 2009, 21:43
Every time I read the title for this forum section "I Like HURRRRR" I hear the rapper Nelly saying it in reference to a lady he may like.

Figured pointless thread would be the best place to post this pointless thought.

Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: Mr. Skawronska on 18 Jan 2009, 21:56
You can improve your lie in the rough, if you can roughly prove you're not lying.

S
Title: Re: POINTLESS THREAD II: ESCAPE FROM RAPTOR MOUNTAIN
Post by: MrSteevo on