Topic: The Science Discussion Thread (Read 24176 times)

Liz · « **Reply #50 on:** 28 Sep 2009, 16:15 »

I should have kept that conversation, really I should have. This is why I now use meebo solely through pidgin- chat logs saved automatically.

Bastardous Bassist · « **Reply #51 on:** 28 Sep 2009, 16:31 »

Quote from: evilbobthebob on 28 Sep 2009, 13:39

I thought about making this a Science thread, but then I decided the arguments would probably get out of hand. Too late

Arguments would have been more avoided, I think, if we had been more inclusive at the beginning. I think my problem with biology people is not actual biology people, but pre-med biology people. My undergrad institution was basically a feeder school for Medical University of South Carolina. As a result, "biology major" or "chemistry major" was pretty much meaningless, because I'm sure it was easy enough for pre-med people. Pre-med people in South Carolina.

Reed · « **Reply #52 on:** 28 Sep 2009, 16:37 »

I just get really tired of hearing physicists talk about how biology isn't as good as physics, or in depth. Honestly, they take completely different mindsets and joining either field involves completely different stresses and problems. I'm pretty sure that most physicists wouldn't be able to understand genetics or even biochemistry like I do, while I don't doubt that I would be pretty terrible as a physicist.

And Liz, the moral of the story is: you need to get drunk and discuss tying up Matt for deviant sexual purposes more often.

Liz · « **Reply #53 on:** 28 Sep 2009, 16:40 »

I was not drunk! I only had two hard ciders in me at that point, there was merely a nice buzz going.

The second bit of that I will keep in mind, though...

Bastardous Bassist · « **Reply #54 on:** 28 Sep 2009, 16:47 »

Oh, no doubt I'm terrible at biology. It requires far more memorization that I am capable of, and I never got past that part so I don't know what else is required. I think incredibly smart people go into all fields.

I commonly make the analogy of violin vs. guitar. Guitar is easier to get a sound out of and it's easier to play things that sound nice, but are the world's top violinists any "better" than the world's top guitarists? They've all probably put in similar amounts of work and are similarly intelligent, but most people would say that the violinists are "better," because violin is "harder" than guitar. I put those words in quotes because I don't believe those statements. Neither is harder, one is just harder to get something that sounds decent. Physics in this analogy is, of course, played by the violin. You need to know a lot more math and a lot more physics before you can ever do any science, but does that make the science done by physicists any harder than biologists? Probably not.

Reed · « **Reply #55 on:** 28 Sep 2009, 16:50 »

See, that's a pretty sad misconception about biology (well, some fields of it). Once you get to grad school, memorization becomes less and less important. If I need to know something about Bradyrhizobium's metabolic pathways I look it up on Kegg. If I need to know HPrK's gene neighborhood, I check out MiST. At the graduate level biology is more about knowing how to set up genetics experiments, or properly purify/assay proteins or whatever other experiment you are doing.

Bastardous Bassist · « **Reply #56 on:** 28 Sep 2009, 17:00 »

I don't know so much about not needing to memorize stuff any more. Maybe you don't need to memorize as much and you've gotten used to it. My buddy is taking a biochem (maybe different type of stuff?) class at the graduate level, and he's having to memorize tons of stuff. Yes, he's having to understand things, but compared to all of the memorization, that's been pretty easy so far. Which is not to say it's been easy. We're taling in relative terms here. Also, maybe physics people are incredibly terrible at memorization from years of not having to memorize anything ever.

Reed · « **Reply #57 on:** 28 Sep 2009, 17:34 »

Well that sounds like he has a not so great biochem professor, potentially your school doesn't have a very good program. At the graduate level he should be learning techniques and how to apply them to research. In grad school a biochemist should be learning how to do research independent of the system that they are working on (which is different from what we learn in micro).

I should probably point out that I can, in fact, tell you the gene order in certain loci in alpha-proteobacteria as well as diagram the ED pathway and TCA cycle, as well as talk about structure and function of the PTS proteins in all the proteobacteria plus firmicutes and a few other families. This isn't due to being forced to memorize any of this so much as repeatedly looking over all of them for the past 2+ years.

Bastardous Bassist · « **Reply #58 on:** 28 Sep 2009, 18:36 »

My school doesn't have that good a program in pretty much anything that doesn't have to do with optics, so that's extremely likely. Are all grad classes for you guys just there to teach techniques rather than provide an understanding of the subject matter? We rarely learn anything to do with how to accomplish something in the lab while in class. It's usually theoretical background that is necessary for an understanding of what we're trying to do.

I also have a number of things memorized due to frequent use, but that doesn't really count.

calenlass · « **Reply #59 on:** 28 Sep 2009, 19:21 »

Medicine is an elabourate process of analysis and occasionally some creative thinking, but it really does take quite a lot to be good at it. There is so much out there to take into consideration! Perhaps a computer would be better at it, but that would be a waste because there is something so incredibly satisfying about coming up with exactly the right answer.

Reed · « **Reply #60 on:** 28 Sep 2009, 20:48 »

We have basic biochem and structural biology classes, but past that are pretty much techniques classes with a few exceptions. I've taken spectroscopy and now I'm taking biophysical techniques (anything from analytical ultracentrifugation to SAXS to light scattering to single molecule techniques). The one big exception is a class called cellular machines, which is a fantastic class where basically you look at structural biology not in terms of individual proteins, but the large complexes that they tend to occur in within the cell. It also teaches you a lot about doing protein structure visualization and analysis on the computer, it was a lot of fun! (yes, I know I am a huge nerd).

Bastardous Bassist · « **Reply #61 on:** 28 Sep 2009, 21:17 »

I think his class is a fairly basic one, since he's not a biochem guy by trade. It's just important for him to know some of that stuff for his research (there are a lot of medical optics people, since there is a hospital attached to our school).

Quote from: calenlass on 28 Sep 2009, 19:21

Medicine is an elabourate process of analysis and occasionally some creative thinking, but it really does take quite a lot to be good at it. There is so much out there to take into consideration! Perhaps a computer would be better at it, but that would be a waste because there is something so incredibly satisfying about coming up with exactly the right answer.

I don't think anybody is debating that the list isn't significant, but it is certainly just a list. They tend to be good at memorization, though and that's something I can't do. Plus, it clearly must attract intelligent people since there's so much money to be had in it.

Reed · « **Reply #62 on:** 28 Sep 2009, 21:42 »

Chances are, he's in a combined undergrad-grad student biochem course. They tend to be pretty heavy in rote memorization (Memorize this metabolic pathway, including all reduced NAD+!).

The sad thing about doctors is that even if they make a lot of money coming out of med school, they still have about $200,000 in student loan debt! And Katie, I did microbiology as an undergrad, which was pretty much the main pre-med major. From my experience the pre-med students tend to be pretty dumb!

Bastardous Bassist · « **Reply #63 on:** 28 Sep 2009, 21:58 »

Not so much rote, but there are a lot of things you just need to know, and that's completely foreign to us physics-types.

Also, I was a physics tutor. Can you guess what most of my students wanted to do when they graduated? Some of them were actually not too bad at 100-level physics courses.

calenlass · « **Reply #64 on:** 28 Sep 2009, 22:51 »

Fuck all yall technical fuckers, I will take my fishy isopods and enormous crabs and fuzzy lobsters any day.

MarkTBSc · « **Reply #65 on:** 29 Sep 2009, 00:53 »

The advantage we technical people have over the Bio people is that when we open something up to check how it works it's usually less slimy and smelly. Plus there are, overall, less fangs and spines.

Operative words here are Usually, Overall and Less.

Plus it's a lot easier to bang together a test rig for a circuit to make sure it does what you think it does than it is to do the same for, say, an Octopus.

evilbobthebob · « **Reply #66 on:** 29 Sep 2009, 01:18 »

This thread is now about all the sciences. And I don't want to get into a discussion about which ones are included

pwhodges · « **Reply #67 on:** 29 Sep 2009, 02:22 »

Ah, memories! Dissecting out the cranial nerves of a dogfish...

Before I went to university and did engineering, my main subject at school was zoology.

the_pied_piper · « **Reply #68 on:** 29 Sep 2009, 02:23 »

Is maths included or are we mathematicians being forced to sit in the corner again while the "cool" guys argue their theorems with our work?

Anyway, today was my first day back at uni, now in my final year of a maths course and get to start studying much more interesting stuff. Today, Medical Statistics, Financial Mathematics and Combinatorics, YAY!!

evilbobthebob · « **Reply #69 on:** 29 Sep 2009, 02:26 »

Yeah, we discussed if mathematics is a science and decided that it is. Well. I said that it is.

However, I don't associate the words "medical statistics" with "much more interesting"

Bastardous Bassist · « **Reply #70 on:** 29 Sep 2009, 06:34 »

Quote from: calenlass on 28 Sep 2009, 22:51

Fuck all yall technical fuckers, I will take my fishy isopods and enormous crabs and fuzzy lobsters any day.

Hey! Biology is cool. Just not medicine.

calenlass · « **Reply #71 on:** 29 Sep 2009, 09:48 »

I am not a biologist.

calenlass · « **Reply #72 on:** 29 Sep 2009, 09:53 »

(Try ecology.)

evilbobthebob · « **Reply #73 on:** 29 Sep 2009, 09:58 »

Ecology is cool! And really important at the moment. Not that it's ever been unimportant.

Bastardous Bassist · « **Reply #74 on:** 29 Sep 2009, 10:35 »

Okay, squishy sciences are cool. They're all pretty much the same to me and my nice and clean technical science. I would like to be interested in a squishy science (or even a squishy application of my technical science), because there's more money in that, but unfortunately I'm not.

KharBevNor · « **Reply #75 on:** 29 Sep 2009, 22:31 »

I'm an artist!

a bloo bloo bloo

David_Dovey · « **Reply #76 on:** 29 Sep 2009, 22:52 »

Quote from: Bastardous Bassist on 29 Sep 2009, 10:35

Okay, squishy sciences are cool. They're all pretty much the same to me and my nice and clean technical science. I would like to be interested in a squishy science (or even a squishy application of my technical science), because there's more money in that, but unfortunately I'm not.

why you gotta be a dick about science man

MarkTBSc · « **Reply #77 on:** 30 Sep 2009, 00:38 »

Y'know what's cool about bio-sciences?

Putting two people in an MRI and telling them to engage in coitus so you can see what happens. Now THAT'S research!

Dliessmgg · « **Reply #78 on:** 30 Sep 2009, 01:57 »

Quote from: KharBevNor on 29 Sep 2009, 22:31

I'm an artist!

a bloo bloo bloo

Art is even harder than science. You have to overanalyze stuff and you don't even have an algorithm!

ViolentDove · « **Reply #79 on:** 30 Sep 2009, 02:36 »

TTGCCCCTGCCACCTCACTCGCCTGCAAGCCCGGTCGCCCGTGTCCATGAACTCGATGGGCAGGTACTTC
TCCTCGGCGTGGGACACGATGCCAACACGACGCTGCATCTTGCCGAGTTGATGGCAAAGGTTCCCTATGG
GGTGCCGAGACACTGCACCATTCTTCAGGATGGCAAGTTGGTACGCGTCGATTATCTCGAGAATGACCAC
TGCTGTGAGCGCTTTGCCTTGGCGGACAGGTGGCTCAAGGAGAAGAGCCTTCAGAAGGAAGGTCCAGTCG
GTCATGCCTTTGCTCGGTTGATCCGCTCCCGCGACATTGTGGCGACAGCCCTGGGTCAACTGGGCCGAGA
TCCGTTGATCTTCCTGCATCCGCCAGAGGCGGGATGCGAAGAATGCGATGCCGCTCGCCAGTCGATTGGC
TGAGCTCATGAGCGGAGAACGAGATGACGTTGGAGGGGCAAGGTCGCGCTGATTGCTGGGGCAACACGTG
GAGCGGATCGGGGATTGTCTTTCTTCAGCTCGCTGATGATATGCTGACGCTCAATGCCGTTTGGCCTCCG
ACTAACGAAAATCCCGCATTTGGACGGCTGATCCGATTGGCACGGCGGACGGCGAATGGCGGAGCAGACG

ViolentDove · « **Reply #80 on:** 30 Sep 2009, 02:38 »

YEAH

GENETICS

(I'm actually a little glad I don't have to stare at that on a screen day in and day out anymore)

MarkTBSc · « **Reply #81 on:** 30 Sep 2009, 02:45 »

Bonus points if you can do that again and make it into ASCII art.

Aimless · « **Reply #82 on:** 30 Sep 2009, 03:57 »

There was a time when I thought I might get into physics. I spent so much of my time reading (somewhat popularised) books about physics that it just seemed to be a given truth. But then something happened and now it's all medicine for me... every aspect of every area of medical science, on all scales from molecules to populations. I love it, because it satisfies my desire to work with things that are clearly human-centric, things that are supposed to lead to better lives for humans in concrete ways... rather than inquiry simply for the sake of acquiring knowledge and a deeper understanding of the universe.

Various areas of medical research also require a deep understanding of other sciences and disciplines, which makes medical science even more interesting... the opportunities to work with people from many different fields, to combine what we've learned from eg. physics and from biology to solve problems... very cool.

Medicine allows me to combine pursuits that are (to me) intellectually very satisfying with goals that are (to me) emotionally satisfying or down-right central to my life and my views.

I've often come accross this notion that doctors don't really need to be scientists, that they instead benefit more from memorisation and from checking off things on a list... I've even seen it in the occasional med-student, my peers... But I personally don't believe you can be a good doctor for your patients if you lack a thorough understanding of the science behind the tools and techniques and strategies that you implement in your work.

I'm not sure why someone would assume medicine and those who practice it are (or should be) separate from the rest of science and the scientific community. Every single med-student in Sweden has a background in natural science at the highschool level at the very least, and tend to love science. Many have studied other areas of science before going into medicine. Many go on to conduct research in various areas of biology, eg. microbiology, molecular biology. Some even go into physics, which is great because physics is very important to modern medicine.

Guys, seriously, people are hopping around all over the place from one discipline to another. We have physicists using evolutionary biology to solve problems in medicine for chrissakes. I think it's awesome, and I think it may be time to let go of the attitude that eg. physicists have a monopoly on physics :p

cheerio

Aimless · « **Reply #83 on:** 30 Sep 2009, 04:17 »

with that said, a compelling argument against interdisciplinary research:

öde · « **Reply #84 on:** 30 Sep 2009, 04:45 »

A compelling argument against that webcomic also.

ViolentDove · « **Reply #85 on:** 30 Sep 2009, 05:16 »

A compelling argument against your mum

MarkTBSc · « **Reply #86 on:** 30 Sep 2009, 05:49 »

I'm curious as to how the herpetoid was accelerated to such a speed as to display no visible drop due to gravity in the space of the frame, through such a short device, without causing fatal injuries to the little fella.

What do you think? Gravitational field mass driver?

Dliessmgg · « **Reply #87 on:** 30 Sep 2009, 09:05 »

A wizard did it.

jhocking · « **Reply #88 on:** 30 Sep 2009, 09:30 »

Just saw this:

Incidentally, I do happen to have a degree in biology and have in fact conversed with my fiancee about the probabilities of our children having blue eyes. I have also explained this to the hygienist at my dentist's office (if I had to explain this to the dentist I would have been a bit concerned.)

Reed · « **Reply #89 on:** 30 Sep 2009, 09:33 »

Trivia: Most biologists don't actually give a shit about punnett squares

jhocking · « **Reply #90 on:** 30 Sep 2009, 09:41 »

Why so serious? 'Tis a comic, people aren't going to look at that and think it's true.

Quote from: evilbobthebob on 29 Sep 2009, 01:18

This thread is now about all the sciences. And I don't want to get into a discussion about which ones are included

What about computer science? Is that really science? I mean, it has the word "science" in the name so it must be, right?

Reed · « **Reply #91 on:** 30 Sep 2009, 09:45 »

It may have been an overreaction, but a lot of people really do think biologists act like that. It gets really annoying!

(Note: I have been really grumpy lately because my research is being stupid and I have a big exam on friday that I forgot about until today)

Bastardous Bassist · « **Reply #92 on:** 30 Sep 2009, 09:55 »

Quote from: Aimless on 30 Sep 2009, 03:57

I love it, because it satisfies my desire to work with things that are clearly human-centric, things that are supposed to lead to better lives for humans in concrete ways... rather than inquiry simply for the sake of acquiring knowledge and a deeper understanding of the universe.

I am studying things that will assist with communication (fiber optics). Discoveries that I make will lead to a world where communicating with other people is cheaper and easier.

Quote from: Aimless on 30 Sep 2009, 03:57

But I personally don't believe you can be a good doctor for your patients if you lack a thorough understanding of the science behind the tools and techniques and strategies that you implement in your work.

This may be true, but that would mean there are an awful lot of doctors out there who aren't good.

Quote from: Aimless on 30 Sep 2009, 03:57

Every single med-student in Sweden has a background in natural science at the highschool level at the very least, and tend to love science. Many have studied other areas of science before going into medicine. Many go on to conduct research in various areas of biology, eg. microbiology, molecular biology. Some even go into physics, which is great because physics is very important to modern medicine.

I've seen a number of MD/PhD people. Not too many of them go on to be practicing physicians. They pretty much always go into research. Just because they got a medical degree doesn't make them a medical doctor, in my opinion. Also, most of the med students I've met got their undergraduate degree in science. At the very least, they needed to take a large number of science classes and understand them well enough to do well on the MCAT. However, their actual working understanding of the material was usually minimal.

Medical doctors are essentially extremely well-educated technicians and well they should be! Do I want my doctor to go into the back room and plug data into a model that will predict, from first principles, my ailment? No, because the human body is not well-understood enough (as of now) to be able to do that effectively. I want somebody to fix my body, not design me a new one.

Quote from: jhocking on 30 Sep 2009, 09:41

What about computer science? Is that really science? I mean, it has the word "science" in the name so it must be, right?

It is, but coding is not computer science any more than designing a bridge is physics. Both use results from the subject, but neither actually goes into the science.

Also, computer science is pretty much just applied math. More than any other field, really.

Aimless · « **Reply #93 on:** 30 Sep 2009, 10:45 »

Quote from: Bastardous Bassist on 30 Sep 2009, 09:55

This may be true, but that would mean there are an awful lot of doctors out there who aren't good.

Yes... that is true...

Quote

I've seen a number of MD/PhD people. Not too many of them go on to be practicing physicians. They pretty much always go into research. Just because they got a medical degree doesn't make them a medical doctor, in my opinion.

*shrugs* I'm talking about people who combine clinical medicine and clinical research. Over time, they often increase the research aspect and cut down on the stressful time-consuming clinical work. Of course, some people go in the other direction

and some stay exclusively in one camp throughout their careers. I find it's hard to generalise :p

Quote

Medical doctors are essentially extremely well-educated technicians and well they should be!

What can I say except that I strongly disagree with this largely unfounded and absurdly reductionistic generalisation? Being a medical doctor doesn't preclude also being a scientist. Often, people are both, which is awesome because medicine relies heavily on science.

EDIT: And I don't feel you can or should reduce the role of a compassionate fellow human being to being a "technician". That's a crucial part of the "job" for a great many doctors.

ViolentDove · « **Reply #94 on:** 30 Sep 2009, 15:55 »

Physics is old news. Molecular biology is obviously the best science because it is the most likely to produce mutants with super-human powers.

the_pied_piper · « **Reply #95 on:** 30 Sep 2009, 16:17 »

Do any of your lectures include basic instructions on making chiptune music?

No, didn't think so. (Chaos theory rules!)

Reed · « **Reply #96 on:** 30 Sep 2009, 16:48 »

Nick, you are so right!

AanAllein · « **Reply #97 on:** 30 Sep 2009, 18:36 »

Posting in this thread! At the moment I'm only really involved with Maths, being a secondary school Maths teacher, and my only involvement with Physics is high school stuff and a lot of casual reading. But I'm starting teaching Physics at school next year, so I'll be going back to do a couple courses at uni to refresh my memory. Looking forward to it - as much as I love Maths, I imagine Physics will be much more enjoyable to teach.

Bastardous Bassist · « **Reply #98 on:** 30 Sep 2009, 18:56 »

Quote from: Aimless on 30 Sep 2009, 10:45

What can I say except that I strongly disagree with this largely unfounded and absurdly reductionistic generalisation? Being a medical doctor doesn't preclude also being a scientist. Often, people are both, which is awesome because medicine relies heavily on science.

EDIT: And I don't feel you can or should reduce the role of a compassionate fellow human being to being a "technician". That's a crucial part of the "job" for a great many doctors.

I'm starting to think that you are thinking of a scientist differently from what I am thinking of as a scientist. A scientist answers questions about how the world works that were previously unanswered. I do not want a doctor doing things that are not know whether or not they work (if it was know, it wouldn't be science!). I want a doctor fixing people, and I call someone who fixes things a technician. Now, doctors use science, of course! How could they not? Well, they could be faith healers, but then they wouldn't be doctors. But so do engineers and as I said earlier, engineers are not scientists.

Also, all technicians are fellow human beings. McDonald's burger flippers are fellow human beings. Not all of them are compassionate, but neither are all doctors compassionate.

Finally, in the above, I mean medical doctors. I just didn't want to keep differentiating between them and other doctors.

AanAllein · « **Reply #99 on:** 30 Sep 2009, 18:58 »

Isn't his point more that medical doctors are often also involved in research, and can thereby be correctly defined as scientists? Hospitals have research wings too.

THESE FORUMS NOW CLOSED (read only)

Author Topic: The Science Discussion Thread (Read 24176 times)